Talk:Haplogroup R1a/Archive 4

Page contents not supported in other languages.
From Wikipedia, the free encyclopedia
Archive 1 Archive 2 Archive 3 Archive 4 Archive 5 Archive 6 → Archive 9

opening of phylogeny section: the odd obsession with naming all SNPs

After several days of posting increasingly insistent notes within the text, saying that there should be some introductory sentence for the phylogeny section, PB666 has inserted some text. I have whittled it back a lot for what seem to me to be very straightforward reasons, which are given in the edit notes. If someone sees an error in my thinking, please let me know. Here is what is left:-

I also want to remove or change this part but it needs more explanation. PB666 has been making a lot of comments about the SNP which distinguish different clades, arguing for example that not mentioning all known ones would be "suppression" of information. The factor of the matter is, as I have explained before, the number and names of the SNPs we know are random chance and not important. There will be hundreds, but papers just mention the first ones that are found. More systematic research is needed before you can read much into them. So looking at the above passage I think it is very odd. Why are active verbs like "produced" and "altered" being used to describe mutations which are not causes but effects? Why is it being emphasized that "4 known SNPs" did the altering in one case?--Andrew Lancaster (talk) 14:00, 17 November 2009 (UTC)

I don't understand what part of known which you do not understand. Second off, if there are 100s of mutations then surely you have proof or precedence, otherwise there are simply an unknown number of mutations alongside the known number of mutations. We don't have to present on Wikipedia what we do not know, only what is known and important.:I stongly suggest, if you want to find faulty in the clarity of the article, please look at the section directly below, in Different meanings of "R1a". I am going to continue to revert the cladogram until you have cleaned up the jargon and lingo in this section, because it is an alternative for people who do not want to trudge through. Again, I repeat the effort is being made to satisfy the comments of an outside reviewer regarding jargon, we have the B-class, but we need to focus on improving this article, not only for this article sake, but as a standard which we should strive to improve all the Y-DNA articles, all which fall at or below the level of this article. The target should not be battling heads with Phil, the target should be reaching out to readers. Specific comments regarding the minutia of this article at this point are of lesser importance.PB666 yap 19:31, 17 November 2009 (UTC)
I am obviously working on whatever I think needs work. I have done my best to explain each thing I change, which is something you do not do, and indeed your comments and edits continue to demonstrate that you are not even thinking about what you are reading. It is called good faith editing. Your demand that I ignore problems that you are not willing to discuss is not valid. Your threat to edit war if people are disobedient to your demands will not work. I have told you what is wrong with the cladogram. If I am making a mistake tell me, but do not tell me that "I am going to continue to revert the cladogram until you have cleaned up the jargon and lingo in this section [...] to satisfy the comments of an outside reviewer". If your own personal priority is to write with less jargon you sure have an odd way of showing it.--Andrew Lancaster (talk) 20:53, 17 November 2009 (UTC)
I have told you three times, the final time above. The cladogram is not intended to be factually correct, its intended to show the contrast in placement of Y chromosomes before mid-2009 and after mid-2009. If the old cladogram was perfect there would be no need for new systematics.PB666 yap 21:00, 17 November 2009 (UTC)
I do not recall you saying that the cladogram is not intended to be factually correct. But anyway, it makes absolutely no sense at all to use this as an argument for keeping it! The old cladogram people used before 2009 was not wrong. It just contained less information because some thing had not been discovered. To pretend that people before 2009 were all making a stupid and impossible mistake, putting M420, a mutation they did not know, in the wrong place in the tree, is nonsense. Why would they have imagined it was in the wrong place in the tree?--Andrew Lancaster (talk) 21:09, 17 November 2009 (UTC)
Andrew, you are as you continue to be in a very argumentative mode, which I have found after years on the UseNet makes no sense to continue discussing, either you approach the problem with an open mind and clear head or we cannot further discuss this.
Whether or not they could detect M420 or not is immaterial, M420 was monophyletic with SRY1532.2 relative to R1b and R1(else); however, by placing them in the R1* category they were treating ancestral versions of R1a (meaning versions intermediate between R1 and SRY1532.2) as being paraphyletic or underived, that is an error in assignment, if you don't want to call it an error then certainly it was a fault, which means it fell short of what phylogenetics desires. The critical error in these works which you fail to place on the page is that they have not done true sequence comparisons between clades, for example R1a1a* and any R1b*. That is part of explaining why there is differences to the layman. Since you don't want to do that I created a cladogram that implies that is what is going on.

Unlike other forms of geneology such as mitogenomics, human Y-chromosome is not generally sequenced. As a consequence errors can be made in the phylogenetics. One such error has been detected in 2009, when SNPs in the lineage between R1 and SRY1532.2 and should have been treated within a single subclade of R1(for example the current definition of R1a) were place in both the R1* clade and R1a (see 'gray' M420 cladogram on right). This indicated that certain R1* had no defining mutations or defining mutations that belong to other clades, but actually belonged in the R1 to R1a lineage. As a consequence of the placement error the R1a* clade needed to be recently redefined. M420 bearing R1 were placed into R1a and R1a (SRY1532 positive) shuffled to R1a1 and R1a1 (M17 positive) moved to R1a1a. Consequently, the subclades of R1a1 (R1a1a to R1a1d) were renamed R1a1a1 to R1a1a4. On this page the modern nomenclature will be used however older nomenclature will be noted, when appropriate.

Consequently the methods they are using are prone to the error which I described and illustrated. The authors are not self-critical of their approaches, however as editors we can be, and we can contrast errors in Y phylogenetics with haploids that are sequenced, like mtDNA. When mtDNA work was largely done with D-loop region major misplacements were made, many times, now that the genomic sequencing was done, such misplacements are rare and of minor significance. You are very hesitant to take a NPOV on the problems with Y geneology, instead you keep pointing the finger at the critic, myself, that I misunderstand the problem. I clearly understand the problem and think that it should lead the definition section so that the user can go forth through the article in understanding the confusion that half-done genetics causes.PB666 yap 21:39, 17 November 2009 (UTC)
The most important point is, for example, reading Sharma et al. 2009 in which the R1* clade is concerned, the reader of that paper does not know whether those detected as R1* (Not R1b) belong in the R1 to SRY1532.2 lineage or in another lineage. IOW paper that do not type M420 are combining mutants that are monophyletic with R1a with mutants that are paraphyletic with R1a. And so yes, it is an error. In addition as I pointed to Underhill and Sharma. Underhill detects no R1* in India, and Sharma finds R1* in many of the same populations that Underhill tested, indicating a contradiction. IOW while R1a* (old) may be comparable to R1a1* new, R1* may not be comparable with R1a* new indicating areas were false conclusions might erroneously be drawn. For example whether or not R1a (SRY1532 negative) is found in India.PB666 yap 21:39, 17 November 2009 (UTC)
If you label something as the pre 2009 phylogeny, it should be that? Just please answer that?--Andrew Lancaster (talk) 22:38, 17 November 2009 (UTC)
I'll put it another way. The diagram you keep reverting states clearly in graphical form that experts in this field before a certain date believed a certain thing about a mutation M420 which was wrong. Actually they did not know this mutation existed. They said nothing about it either right or wrong. Also they allowed space for it's possibility. It came as no shock. In other words they did not predict that M420 would be discovered but different that it turned out to be. You are simply fabricating the facts.--Andrew Lancaster (talk) 22:46, 17 November 2009 (UTC)
  1. Whether or not a pilot knows that his aircraft is going to crash does not change the fact that the aircraft crashed, even if the pilot is aware of the fact that the airplane can crash under the circumstances that the airplane crashed, he can still be faulted for crashing the AC. In wikipedia we can discuss the fact that the airplane crashed and the fact the pilot was unaware of the fact because of a misconception. So that particular logic you use is not important. They were at fault. I am not fabricating facts, that has already been done, I am analyzing the source of error, which you refuse to do.
  2. The only correct critique you have made so far is this: Also they allowed space for it's possibility. But if we think about this objectively a clock is right at least twice a day. The R1* designation is actually a composite of different possibilities (or to state otherwise potential mixtures of monophyletic and paraphyletic phenomena)
a. Y-DNA representing the unique common ancestor of all R1
b. Y-DNA representing new true subclades of R1
c. Y-DNA that are monophyletic with unique mutations in the R1-R1a
d. Y-DNA that are monophyletic with unique mutations in the R1-R1b
IOW, its an ill-defined phylogenetic bag. Why is it an ill defined bag, because a clearly approachable technique, sequencing, with clearly approachable comparators, R1-anything (outgroup) R1b and R1a can be sequenced and all the defining mutations done. Its the same as a pilot failing to read the NOTAM properly and accidentally using the wrong navigational aid. It may not appear to be a fault to you, but it is a fault.PB666 yap 23:22, 17 November 2009 (UTC)
They were not "at fault" and they did not believe M420 was in the place where you put it, and neither do people believe it now. You "old phylogeny" is from an alternative universe. To use your plane analogy it is like making a diagram of how a plane crashed which never did crash. Please give a source for your "old phylogeny".--Andrew Lancaster (talk) 06:54, 18 November 2009 (UTC)
When you come to a point in which you can be reflective about the faults in the Y genetic geneology, then you might be able to write and argue that which is understandable by the common reader. Until such point that you continue a stance of defending that which is flawed, you will have difficulty explaining why the faulted needed to change, and you will continue to defend jargon that is confusing instead of offering nomenclature that clarifies and helps to organize the article. Arguing with me will not clear up the section that you wrote. PB666 yap 15:05, 18 November 2009 (UTC)
This section Different meanings of "R1a" is the most jargonistic section of the article. If you take the time to write it out more carefully, put things in notes that don't need to be in the main text (like Page07=rs######) and keep new jargon to less than a couple of items per sentence, then if I can sit down and read through it an not be confused or distracted by the Jargon, then I might revert the image. If I have to come back and do this, am I going to end up doing it for all (Y_DNA) articles. You called me into mediate your conflicts, instead I found train-wrecked pages that are the true source of the problem, the training period is over, its time to fix these things yourself.PB666 yap 15:05, 18 November 2009 (UTC)
I do not see it the same way. First, I believe I have been removing jargon quite well, a job I do not claim that I ever got to finish, and you have been inserting it just as rapidly in the midst of unreadable part-sentences. It might be "personal" but it is obviously important to point out that I think it is clear now that what you find readable and good style is nothing like what most people find readable. In other words you are NOT an authority on that subject. Sorry. Please let other people clean up the English. Secondly, I would like to be allowed to once again edit Wikipedia rather than negotiate with you constantly about your deadlines, threats to edit war, and insistences upon personal preferences. You are making it very difficult. Thirdly, yes of course everyone agrees that the article was a mess at the time I asked you to look at some issues on it, but since then positive work on this article had been progressing at a reasonable speed until the moment you started making your major unilateral changes and your demands to other that they should clean up after you in ways specified by you. If this continues to be your main contribution to the article then obviously it is not positive.--Andrew Lancaster (talk) 15:25, 18 November 2009 (UTC)

Again, these protracted discussions only point to the fact we are not whole-hearted about improving the article, only arguing about improving the article. This is going to be reflected on by the articles referees. Secondarily, yes you were offended by dead-lines, but no, despite the claims the article was improving, it was improving at a snails pace. And third, I actually muffled my discontent with the jargon because I felt to say more was overburdening. You don't seem to get this process, there is no I in we, I don't expect my edits to last, what I have done is to provide the impetus and fodder for improvement. If you claim MarmadukePercy is such a wonderful English copy editor, we need to get the article to a point that those edits will be obvious. I have noted that really sorry articles in Wikipedia are seldomly copy-edited. We, collectively, have to bring the little factoids here to a grammatical and wiki-standard in which a copy-editor is going to be able to turn our wall-flowers into a portrait. Jumping all over bold edits is not going to get us there. The complaint is the article is full of jargon, but you and I both want content that someone of both your and my level would find useful. That means we double the task, because not only do we have to provide this content, but we have to make it accessible to newbies. There is much more than just words, there are diagrams, images, etc that are required.PB666 yap 01:38, 19 November 2009 (UTC) Lets show these referees that we can work together, and that we will listen to what they say and try to pre-empt comments by improving the article before the reviewing process begins. Trust me, there will be alot of comments, they may even wonder how the article was promoted.PB666 yap 01:38, 19 November 2009 (UTC)

Suggested replacement for the lead

[Its not a complete lead, but it certainly more descriptive than what is present]


haplogroup R1a is the name given to a major human Y-chromosome haplogroup within R1 (R-M173). In other words, it is one of the major male-lines of all humanity. It is found at high frequencies in a wide geographic area extending from South Asia to Central and Eastern Europe and Southern Siberia.

R1a is believed to have originated somewhere within this same area in Eurasia, most likely in the area from Eastern Europe to South Asia. R1a, R1a1, and R1a1a are defined by single-nucleotide polymorphisms named M420, SRY1532.2 and M17, respectively. So far, 8 sub-clades of R1a1a are known, however only three subclades are known to have significant frequencies R1a1a3, R1a1a6 and R1a1a7.

R1a has been found in high frequency at both the eastern and western ends of its core range (e.g. in some parts of India and Tajikistan , and Poland on the other) and both ends are dominated by R1a1a. The highest frequency level observed in any large population so far has been found in some South Asian groups. On the other hand, until 2009 claims regarding the oldest R1a bearing populations varied greatly between different articles. Some of the older articles supported origins in Central Asia and Europe. In 2009, two large studies of available data concluded that there are two separate "poles of the expansion" with similar ages, with South Asian R1a1a older than European R1a1a. Both articles felt the data to be most consistent with Asian, as opposed to European origins for R1a1a, and, in particular, South Asian origins.

-End suggested lead.PB666 yap 19:31, 17 November 2009 (UTC)

For contrast here is the current version...

Haplogroup R1a is the name given to a major human Y-chromosome haplogroup within R1 (R-M173). In other words, it is one of the major male-lines of all humanity.

It is found at high frequencies in a wide geographic area extending from South Asia to Central and Eastern Europe and Southern Siberia.[1]

R1a is believed to have originated somewhere within this same area in Eurasia, most likely in the area from Eastern Europe to South Asia.

Can you explain what your aims are? All of what you are adding here is discussed in other parts of the article right now?--Andrew Lancaster (talk) 20:46, 17 November 2009 (UTC)
WP:Lead The lead section, lead (sometimes lede), or introduction of a Wikipedia article is the section before the table of contents and first heading. The lead serves both as an introduction to the article and as a summary of the important aspects of the subject of the article.
  • The lead should be able to stand alone as a concise overview of the article.
- The current version does not stand alone for example as per good article or featured article.
  • It should define the topic, establish context, explain why the subject is interesting or notable, and summarize the most important points—including any notable controversies.
_ the current lead does not.
  • The emphasis given to material in the lead should roughly reflect its importance to the topic, according to reliable, published sources, and the notability of the article's subject should be established in the first sentence of the lead, if possible.
  • While consideration should be given to creating interest in reading more of the article, the lead nonetheless should not "tease" the reader by hinting at—but not explaining—important facts that will appear later in the article. The lead should contain no more than four paragraphs, should be carefully sourced as appropriate, and should be written in a clear, accessible style to invite a reading of the full article.
- the current lead does not.

PB666 yap 20:56, 17 November 2009 (UTC)


I am looking hard but not one of those recommendations says that the lead should be padded with material duplicated from the main article. Can other editors please give opinions?--Andrew Lancaster (talk) 20:58, 17 November 2009 (UTC)
The previous lede is better than the proposed revised lede. (That said, the previous lede could use some work too.) The lede in any piece is not designed to be stand-alone. Yes, it should give a summary of the piece, but it is not designed to be freighted or overloaded with all the minutae that will follow. It should be clean and readily understandable, and as much as possible, avoid the trap of adding too many technical terms. They can follow in the main piece, and should then be adequately explained for readers, but stuffing it all into the lede makes it ponderous, leaden and offputting. MarmadukePercy (talk) 21:19, 17 November 2009 (UTC)
No, According to WP:LEAD - "The lead should be able to stand alone as a concise overview of the article." In its current form it does not, if I thought my version was a suitable replacement I have no fear of WP:BOLD. Ergo both should be merged and tweeked. PB666 yap 21:50, 17 November 2009 (UTC)
Major sections leads should also do the same for their sections. Concise overviews by themselves should, when combined and cropped, be easily fashioned into the lead. Is there anyone here who has ever worked on a good article or featured article?PB666 yap 21:53, 17 November 2009 (UTC)
FYI, there are editors here who have worked on essays and articles every bit as valid as anything on wikipedia. Quit making personal attacks and insinuations and lecturing people about wikipedia parliamentary points-of-order, and engage. MarmadukePercy (talk) 03:11, 18 November 2009 (UTC)
You stated something incorrect, FYI, and I corrected you. If this article has so many experienced Wikipedians why was it such an insufferable piece of crap and why was it listed as needing attention. Or the better question to ask with all those experienced Wikipedians that love this article, why is it that this and 50 other Y-DNA articles are in such miserable shape. Judge the tree by the fruit it bears. There is apparently a very hard lesson being learned here, it is amazingly more difficult to put the reader first than it is to fill an article with opinion. When we can get over this hump in understanding, you guys will stop arguing with me and start going about wikifying articles and making the more encyclopedic. Time wasting arguing with me does not a good article make. If you and Andy don't like my proposal, sit down and hash out a better one. I am just trying to comply with the outside critique.PB666 yap 05:05, 18 November 2009 (UTC)

I stated nothing incorrectly. Let's cut to the chase. The reason this article is 'such an insufferable piece of crap,' as you put it, is because you attempt to handle the whole thing yourself. Perhaps you know something about genetics. You don't know the first thing about language. I know little of genetics, but quite a bit about language. The way to make these articles work is for each contributor to seize on his strengths – and admit his weaknesses. You're trying to do it all, even though there are areas where you're not competent. If you want this piece to be more than "an insufferable piece of crap," then you need to collaborate with others who are better at some things than you are, and perhaps not as good at other things. End of story. MarmadukePercy (talk) 03:20, 19 November 2009 (UTC)

PD, neither Marmaduke nor I were responsible for older versions of the article. We have been working on it recently, like you. Right now proposals are being made and explained by others, so lack of proposals is not the problem. The problem is that most work is now being blocked by the personal tastes of one editor, who has decided to take control and cite his own opinions as Wikipedia policy. Your definition of the blockage is effectively saying that everyone should start obeying you. As usual in Wikipedia, this approach does not work.--Andrew Lancaster (talk) 07:03, 18 November 2009 (UTC)
To put it very kindly, there is at least nothing obvious about your preference in the guidelines you state. To me it just looks padded and eccentric, but that's just me personally. Other people will have other opinions. So please make the case about WHY you think one version is doing the job better than the other, rather than just asserting your preference to be "the rules".--Andrew Lancaster (talk) 22:36, 17 November 2009 (UTC)
There are at least two things that the following articles have in common Wind, Fungus, Zelda_Fitzgerald, Trial_by_Jury, DNA, On_the_Origin_of_Species. Each of the give a well written and ample overview of the article, each of these is a featured article. Here is an article about the same size as ours.

The Cretaceous–Tertiary extinction event, which occurred approximately 65.5 million years ago (Ma), was a large-scale mass extinction of animal and plant species in a geologically short period of time. Widely known as the K–T extinction event, it is associated with a geological signature known as the K–T boundary, usually a thin band of sedimentation found in various parts of the world. K is the traditional abbreviation for the Cretaceous Period derived from the German name Kreidezeit, and T is the abbreviation for the Tertiary Period (a historical term for the period of time now covered by the Paleogene and Neogene periods). The event marks the end of the Mesozoic Era and the beginning of the Cenozoic Era.[1] With "Tertiary" being discouraged as a formal time or rock unit by the International Commission on Stratigraphy, the K–T event is now called the Cretaceous–Paleogene (or K–Pg) extinction event by many researchers.[2]

Non-avian dinosaur fossils are only found below the K–T boundary, indicating that non-avian dinosaurs became extinct immediately before, or during the event.[3] A very small number of dinosaur fossils have been found above the K–T boundary, but they have been explained as reworked, that is, fossils that have been eroded from their original locations then preserved in later sedimentary layers.[4][5][6] Mosasaurs, plesiosaurs, pterosaurs and many species of plants and invertebrates also became extinct. Mammalian and bird clades passed through the boundary with few extinctions, and evolutionary radiation from those Maastrichtian clades occurred well past the boundary. Rates of extinction and radiation varied across different clades of organisms.[7]

Scientists theorize that the K–T extinctions were caused by one or more catastrophic events, such as massive asteroid impacts (like the Chicxulub impact), or increased volcanic activity. Several impact craters and massive volcanic activity, such as that in the Deccan traps, have been dated to the approximate time of the extinction event. These geological events may have reduced sunlight and hindered photosynthesis, leading to a massive disruption in Earth's ecology. Other researchers believe the extinction was more gradual, resulting from slower changes in sea level or climate.[7]

Notice that they are using the lead to explain very complex terminology used in the article while at the same time overviewing the article. Consider topics covered in the article R1, R1a, R1a1, R1a1a, R1a1a6, R1a1a7. Consider terminologies used in the article SNP, STR, Coalescent time, diversity, distributions. Consider concepts raised in the article, Pliestocene migration, Mesolithic migration, Neolithic Migration, Kurgan Migration, Bronze Age migrations. Given the support for any object or concept one may or may not place these in the lead, but if one provides no adequate coverage of the major ideas and section topics, one is not providing a good quality lead.PB666 yap 05:22, 18 November 2009 (UTC)

The text you proposed simply has none of the virtues you claim for it. Sorry. People simply do not agree with your taste on these matters.--Andrew Lancaster (talk) 06:56, 18 November 2009 (UTC)

Neolithic/CWC Again

Actually I think Kasperaviciute (2004)is suggesting that the R1a MAY have spread during the time of the CWC based on level of differentiation compared to Y chromosome N. Andrew when you "debutchered" that section did you look at the right study? Maybe I pasted the wrong reference but I think there are two different Kasperaviciute studies. Geog1 (talk) 15:34, 18 November 2009 (UTC)Geog1

Hi Geog1, yes I looked at it, but the article mentioned many types of aging and migrational possibility. Certainly the words I changed did not match it, but there might be another way to mention it there.--Andrew Lancaster (talk) 15:41, 18 November 2009 (UTC)

pb666 going for it

This edit is a revert insisting on calling a mutation "page07" which is clearly a reference to a page number in an article being referenced in a source. To use it here in Wikipedia we'd need to explain this very indirect referencing. As it happens we do not need to, because the article being referenced to provides Table S5, which gives standardized rs numbers for this and other mutations:

Table S5: Description of R1a associated SNPs

M417 rs17316771 R1a1a* G to A 283 153 TGCAGAAAGAAGAGGAGGACAGCCATGTGTAGTTGGGGGACCACATCC 21
M420 rs17250535 R1a* T to A 275 26 GGCAAACTTTTCATTGCTGG CTAAAAAAACTTAACCCATCACAC 21
M448 rs17222202 R1a1* T to A 317 107 GTGAGAAAGAGAAATGCCAGG GACATACATCCTCTGTTCCC 21
M449 rs17306692 R1a* C to A 317 138 TCAACCAACAATTTGCAACCC TCTGTGAGCAAGGTGACAGC 21
M459 rs17316227 R1a1* A to G 316 149 TGAAGATGCAAAACCAGCACG CAATAGTCTCACAAGAGAAGAAATG 21
M511 rs17307677 R1a* T to C 322 264 GGATGAATTGATGAAGAGATGT CTCAGAGAAAAGACATTTCAG 21
M512 rs17222146 R1a1a* C to T 356 161 TGTTCCTCTGTGAGACTGAGC CAGAACCATGTCATATCAGG 21
M513 rs17222573 R1a* A to G 319 137 GAGATCTTCACTGTCCTTTTTAC GTGTATTTGAAATGGTTCAGGTG 21
M514 rs17315926 R1a1a* C to T 377 245 CTTTTTCCTTATGACAAGATTTC GAATACCTGTTGTATCTTAGC 21
M515 rs17221601 R1a1a* T to A 233 112 GTATTGTCCATATAAGGTCTCTG CCAAAGTGCTGGAATTACAGATG 21
M516 rs17307105 R1a1* A to G 263 173 CTTCTGAACATAAGTGTTCAGG AGTCTGGTTTTGGTTAAAAGC 21
none rs17250901 NT A to T 380 272 AGAAGAGATTTCTAGCCAGAGT GGGGTAGAAAATTATTGGTC 21
Page07 rs34297606 R1a1a* C to T 333 62 CTGACCCCTGACTCCAAGCA AAAAAAGAAAATGGGGACTCACTG 22
Page68 rs34351054 R1a1a8 C to T 340 41 AGAATTGCTTGAACTCTCAGAC GAGATACCTGGAGGTGAGAAG 22
M334 unassigned R1a1a7a C to A 499 356 CCTTGGCATTTTGTTTGGGCTGG AAAGGGGGCCTGAGTGAGCACT this study
M434 unassigned R1a1a6 G to A 325* 213 CCAAAATTAGTGGGGAATAGT GATCACCCAGGGTCTGGAGTT this study
M458 unassigned R1a1a7* A to G 283 87 AGAAGAGATTTCTAGCCAGAGT CCAGAAAAAAATAATTCCTGGA this study

I would like other editors to please comment on whether they see me making any gross errors, or perhaps I am just editing emotionally as per the repeated accusations of PB666?--Andrew Lancaster (talk) 22:59, 17 November 2009 (UTC)

I agree the names is silly (screwy as I referred to it) however That is what underhill called it in the main text of the article. I am not asking you to call it Page07 or Page68, these two mutations are defined by a third party, what if they called it rs34297606, then simply reference the third party and use the rs tag.PB666 yap 23:07, 17 November 2009 (UTC)
Let me clarify what I am asking you, Underhill uses on version in the main text, but he refers to mutations documented by another group Repping et al. Repping et al appears to have used R1a* as their reference sequence see figure 2. (I should state for clarity since someone around here has a tendency to blow things all out of proportions, by 'appears' I mean it is not certain that this is R1a* or some other R1 but the reference sequence was an R1*). One of the authors of the paper has the last name Page (David C Page, HHMI Cambridge, Massachusetts), so that the mutation may be named after the author, that may be its common name. Again by precedent we are not using rs####### nomenclature. I was asking you, before you changed it, to look up the nomenclature and confirm the rightness or wrongness of your assumption. PB666 yap 00:51, 18 November 2009 (UTC)
PB666, the above passage quoted in full shows that the rs nomenclature is used by Underhill. He also mentions these mutations in the review article he wrote with Kivisild. The rs nomemclature is a recognized standard and we have not discussed any "precedent" which says otherwise. Your speculations on the authors surname are not important here.--Andrew Lancaster (talk) 06:50, 18 November 2009 (UTC)
PB666 has replied, or not really replied, on his talkpage as follows, starting by quoting me:- "The rs nomemclature is a recognized standard and we have not discussed any "precedent" which says otherwise. however true that may be, that is not what you have been using in your articles, IOW you personally established a precedence, by changing that precedence ad lib may confuse the reader and will make the article more jargonistic. You have not given a good reason yet for changing the name, you are only trying to cover up the fact that you made a possible missassumption about the origin of the name (a page, versus the proper name Page), and I consider this bad faith."
I want to point out how simple the situation is:- the rs name and the "page" name both occur in the Underhill article, but only one of them is a known standard name which is easy to look up for anyone. The very fact that we can have different theories about what the "page" means is kind of indicative of the problems with that particular name. The mutation's rs name has appeared in other articles by Underhill for example.--Andrew Lancaster (talk) 15:45, 18 November 2009 (UTC)
To respond to this point and this point only. We need fewer standards not more, we are already interchange R1aX with M###, to add yet another level to this would only increase the confusion. We are not bound to use all versions that Underhill uses, only the versions which are most encyclopedic, and i don not think rs####### are appropriate for use in an encyclopedia if other nomenclature is available. And there is one key indicator of which standard we should be using: not all properly named markers have assigned rs########, but all rs###### have proper names. This suggests that we should, at least for the moment adhere to the proper names and leave the 'non-redundant genomic DNA identifiers' for molecular engineers who read these paper, which, by the way, I am one. Anyway, I left Andrew with a more appropriate option, that is to move the non-essential mutations to a reference notes and thus he can assign, if he needs to, rs tags to properly named mutations.PB666 yap 01:41, 19 November 2009 (UTC)
I agree with your principle, but not your supposed way of achieving it. We should have fewer standards, and the most standardized standards, and the simplest possible referencing. So on this basis, why are you always insisting on the opposite in practice? The "Page" reference is not a normal standard and does not look like one. The rs numbers are normal standards, and they look like standards. No one will need to make theories about where they come from, nor look up a footnote. A standard is a standard. You do not have to be a molecular engineer to see that the rs number is a reference number, just like "M420". It is nothing more. It contains no "molecular engineering". Terms like Page08 are on the other hand not clear to you, me, or anyone else. Please be reasonable. Your proposal to make a footnote is odd given that you claim that you are trying to make things simple.--Andrew Lancaster (talk) 06:38, 19 November 2009 (UTC)
PB666, I see you are still pushing this [1]. Your whole approach to this question seems strikingly inconsistent and eccentric. I want to point out a fwe very simple things:-
  • Your edit comment says that "Still Andrew has not justified this exception to the nomenclature used in the clade". Is that really true? Look above. I see your argument changing. I see answers to every concern you come up with. I see no final response from you.
  • Your original reason for this preference of yours was very clear: "rs34297606 is not given by underhill, he uses Page07 either use what they use or provide the reference for rs34297606" [2]. As you know, I was able to show that this is not true. The referred to article does use this name, as do other articles such as this one, which has the virtue of being an important review article of the whole field: Underhill and Kivisild (2007), "Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing Human Migrations", Annu. Rev. Genet., 41: 539–64, doi:10.1146/annurev.genet.41.110306.130407
  • A new element to your complaint is that this nomenclature is "an exception". It is not even clear what this means. Page07 is very obviously also an exception. We have no "M" number for this mutation which we can cite.
Can you explain your approach?--Andrew Lancaster (talk) 08:33, 20 November 2009 (UTC)
And again [3]. Comment this time: "Stick to one naming convention". Which convention are you referring to? Is Page07 within some convention? If so, is it the same convention as the other mutation names in this article?--Andrew Lancaster (talk) 13:43, 20 November 2009 (UTC)

Response to Small Victory/Sophian

  1. Underhill used these ("Page07" and "Page68" named after Redding et al. author Dr. Page) in his figure along with 5 other proper names, R420 being one. He did not use the rs tag. Why do you think you are more qualified than he is to determine the proper label?
  2. I asked you to confirm what the original author, Redding named it, you did not confirm.
  3. I read the redding paper. Page is a coauthor. The mutation is not named after a page, I read all of the supplimentary materials, there is no Page 7 or Page 68.
  4. We (you largely since you're going alone editing now) are not using the rs######## labels for any other SNPs. In fact you are using R-M### as part of the clade names and section heads, increasing the reasoning
  5. rs####### are unencyclopedic names, this is an encyclopedia, not your personal desk reference.
  6. It adds one more level of nomenclature we do not need.
  7. If we were to convert to rs####### there are Underhill described mutations that lack rs numbers.
  8. You keep messing up the cladograms which I carefully edited to have them match borders.
  9. While you have been editing these you have made changes that have changed labels and shifted formats, indicating that you do not know what you are doing.
  10. If it is required I will crop an image of Underhills figure so that it can be place here for others to see as well as an image of the pdf showing the authors name. Since the blood pressure in yours eyes has obstructed your sight.PB666 yap 23:08, 20 November 2009 (UTC)
  11. I gave you the option of using footnotes to reference this jargon off the main text, so that the material would not be lost, you refuse, and you clutter both the cladogram and main text with unnecessary text, when shorter less jargonistic text will suffice.

Two talk subpages

I have created two subpages to hopefully streamline revision of this article.

  1. Proposed Lede
See my notes there.--Andrew Lancaster (talk) 09:06, 19 November 2009 (UTC)
  1. Since there is an ongoing discussion on my talk page on how best deal with the jargon in the Phylogeny (Family Tree). I have moved the proposals to this page as it is more appropriate. Proposed Nomenclature.
I have started discussion about the proposed lede for this sub-section below, on this talkpage. For the other sections, I'll start work over there.--Andrew Lancaster (talk) 10:00, 19 November 2009 (UTC)
Update. Discussion on this supposed draft did not go ahead. After I posted extensive remarks, PB666 expressed frustration that I would take the draft so seriously, explaining that the actual "wordage" would need to be altered, but that "This was supposed to be me assisting you toward improving that section of the page, not vice versa [...] I did not want to put this much work into this, I was simply trying to point the direction". "I would hope that you will take the initiative at this point [...] The page will not self-improve if you also do not self-improve". On his talkpage he has gone much further: "my focus is on improvement not discussion [...] It could almost be interpreted that by excessive points of discussion you might want to obstruct the improvements or replacement of your text, is this your intent?"
So the summary is that this was not a draft in the normal sense, nor in the sense described when PB666 proposed that people should make remarks on these pages which would lead to an ever improving version. These were just examples for other people to think about, as a kind of education by PB666. My personal opinion on this approach, and the responses I eventually received is quite negative, but at least things are clear now about this draft page.
Looking forward concerning the phylogeny section of the article, it is however inexplicable to me that PB666 is saying that all he wants is for me to do the editing, and that he does not have time for it. His actions seem to show a very different direction.
I should point out that in contrast, concerning the lede draft page, PB666 has engaged in some level of discussion.--Andrew Lancaster (talk) 09:23, 20 November 2009 (UTC)

I would invite everyone to offer changes, however I would politely asked that their be restraint from ad-hominim attacks, or derogatory comments, and that the effort should be in editing, not harassment. If you see a spelling or grammar error, fix it. If something is missing, add it, if its too much remove it.PB666 yap 02:41, 19 November 2009 (UTC)

This exercise is pointless repetition UNLESS you make some attempt to explain to others, in a convincing and specific way, and indeed avoiding ad hominem, what problems you see yourself as improving with your proposals.--Andrew Lancaster (talk) 06:57, 19 November 2009 (UTC)
Other editors please participate in this discussion? I have noted comments below and on two of the draft pages mentioned above.--Andrew Lancaster (talk) 21:27, 19 November 2009 (UTC)

Going through your draft:

Phylogeny (Family Tree)

Current version of section lede:

The most recent publications on this subject have increased knowledge of the complexity of the R1a.[1][2] It has been shown that by far the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Each major branching of this tree has a corresponding set of known (as well as unknown) SNP mutations which can be used to test individuals as well as the links between branches as more information becomes available.

Your proposed version?

The most recent publications on this subject have increased knowledge of the complexity of the R1a.[1][3] It has been shown that by far the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Each major branching of this tree has a corresponding set of known (as well as unknown) SNP mutations which can be used to test individuals as well as the links between branches as more information becomes available. The genetic markers SRY153.2 and M17 are the most commonly tested markers for R1a. Recent work has shifted their placement in the tree relative to the R1 parent clade. In addition new clades of grouped with M17 have been identified that have significant distributions.

So (you should be explaining) you seem to want to lengthen this lede. Why? (And please do not say that ledes have to be long according to Wikipedia policy.) All the information being mentioned here is discussed in no significant extra amount of detail very close to this same lede section, so this is simple repetition, and not summarization. For example compare these:-

  • Sentence you want to add: The genetic markers SRY153.2 and M17 are the most commonly tested markers for R1a. (Note: use of present tense, but we are describing the past? These markers are now seen as markers for clades within R1a. Your wording does not exclude this possibility, but it is unclear. Also note mistyped mutation name.)
Thanks, corrected typo. The passage was added for M420 with more editing. (un-signed comment by PB666)
  • Sentence already nearby: Prior to 2009 the mutation SRY1532.2 (or SRY10831.2) defined R1a, and this is also ho

w the term R1a is most often used in publications before 2009.

Sentence had been edited out. (un-signed comment by PB666)
  • Sentence you want to add: Recent work has shifted their placement in the tree relative to the R1 parent clade. (Note, this description of the shift is wrong or at least unclear. R1a remains rooted to the R1 clade in the same way as before, or that's how it could be described.)
True, but insertion of branches logically shifts their position outward, of course in reality only or perspective has shifted, "known phylogenetic tree added but simpler lingo is desired. (un-signed comment by PB666)
The problem is that we could find the right words to explain exactly what has changed, BUT that is exactly what the aim of the below section is, and nothing more. You are moving all content into the lede!--Andrew Lancaster (talk) 07:57, 19 November 2009 (UTC)
  • Sentence already nearby: In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".
  • Sentence you want to add: In addition new clades of grouped with M17 have been identified that have significant distributions.
  • First please re-write the sentence so that it means something. Note: if you insert something like this in the main page, someone will probably either remove it, or else try to save it and perhaps make it worse by trying.

It seems to me that when you edit you are not trying to keep in mind what is already written in the article. When changing one place, you need to keep the structure and flow of discussion and avoid sending the reader in new directions, or repeating things excessively. You are doing this both in your main page editing and on talk pages, and if you stopped doing it, I really think all this extra discussion would be un-necessary.--Andrew Lancaster (talk) 07:20, 19 November 2009 (UTC)

And consider that you drafted a version in mid-edit.
This un-signed comment by PB666, but please also note that he (confusingly) also edited the texts in my above post! [4] I am trying to adjust it so that this can be followed. PB666's new version is here:---Andrew Lancaster (talk) 07:57, 19 November 2009 (UTC)

The most recent publications on R1a have greatly increased knowledge of the complexity of the R1a.[4] This research demonstrates that the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Two lower branches of the R1a tree have a corresponding set of known 'mutations', called SNPs, which can be used to test individuals and improve classification. The SRY1532.2 and M17 SNPs are the most commonly tested markers for R1a. Evaluation of a new marker, M420, has shifted their placement in the known phylogenetic tree relative to the R1a's parent clade. In addition, new clades, which group with M17, have been identified, and at least 2 have significant distributions.

— PB666 next draft
  • Sentence you want to add: Evaluation of a new marker, M420, has shifted their placement in the known phylogenetic tree relative to the R1a's parent clade.
Please note that this is confusing English. The reader needs to search for what "their" refers to, but it refers to two "markers". This is a mixed metaphor: markers are being moved about on trees. Furthermore, as mentioned above the wording "shifted their placement in the known phylogenetic tree relative to the R1a's parent clade" does not have a clear and precise meaning for people who do know this field. You could equally say that the position has not changed at all. As mentioned above, The problem is that we could find the right words to explain exactly what has changed, BUT that is exactly what the aim of the below section is, and nothing more. You are moving all content into the lede!--Andrew Lancaster (talk) 08:03, 19 November 2009 (UTC)
Ledes are for layman, so I don't have a problem with a slight dumbing down, at that point; however, it should be avoided in the subsections. As for their, I see your point, I don't like to use the word and will find a way around it.
It has been reorganized and wordage has shifted, or un'shifted'. Some aspect of the content should be in the lede, the key word is aspect, as in not a full disclosure, but a sample.PB666 yap 08:42, 19 November 2009 (UTC)

The most recent publications on R1a have greatly increased knowledge of the complexity of the R1a.[5] This research demonstrates that the most commonly found type of R1a, now known as R1a1a, represents only one branch of a bigger "family tree". Two lower branches of the R1a tree have a corresponding set of known 'mutations', called SNPs. Evaluating these for cases typed as R1, R1a's parent clade, improves classification. The SRY1532.2 and M17 SNPs have been the most commonly tested markers for R1a. Evaluation of a new marker, M420, has altered our knowledge of the placement of SRY1532.2 and M17 within haplogroup R1. In addition, new clades, which group with M17, have been identified, and at least two have region specific distributions.

— PB666 after next draft

[indent out] PB666, this discussion is not functioning yet unless you read what people write and ANSWER IT. You have demanded a lot of time and effort from fellow editors, under threats and deadlines, and I have once more given detailed remarks, which include some very basic problems with what you are proposing. You have not answered me at all, apart from fixing some of the most obvious mistakes. Most importantly, you need to explain what is worse about the versions you are replacing, and what is better about your proposals. You need to explain your aims. Are you just proposing change for change's sake? For what its worth, your explanation above, or what can be understood of it, seems to have nothing to do with the reality we live in. You say you dumbed down the lede, but you did not. You made it longer, and far more complex and difficult to read without adding anything of value that I can see. --Andrew Lancaster (talk) 09:50, 19 November 2009 (UTC)

Y-DNA haplogroups by ethnic groups

The above article has been listed for deletion. The discussion is at Wikipedia:Articles for deletion/Y-DNA haplogroups by ethnic groups. Wapondaponda (talk) 04:22, 19 November 2009 (UTC)

An example of the problems with this piece

Can anyone tell me what this paragraph means?

"The naming systems commonly used for this haplogroup remains inconsistent in different published sources. Although it has not yet used much in published surveys, the most comprehensive survey of the known mutations is listed by ISOGG, and an equivalent tree is given in Underhill et al. (2009).[4] Prior to 2009 the mutation SRY1532.2 was commonly used to identify "R1a". This is also how the term R1a is most often used in publications well into 2009.[5] However the term "R1a" is increasingly used to refer to a broader family. This includes the "old" R1a and certain lineages within R1* that have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2 moves from "R1a" to "R1a1"."

This is the sort of verbiage that chokes scientific mags but that wikipedia should cut at all costs. It is a hindrance to readers. One shouldn't expect readers of an encyclopedia to know what ISOGG is, much less be impressed by the reference. Most of this piece needs to be translated into everyday English -- and that's assuming the underlying science is correct. It's also as important that the grammar be correct as the science: 'naming systems' is plural, so the verb should be 'remain' and not 'remains.' These are not small considerations, and should receive equal weight in a piece designed to be literate. MarmadukePercy (talk) 05:38, 20 November 2009 (UTC)

Marmaduke, please do correct any grammar or spelling mistakes in the main article of course, and if you can propose any better wording or way of avoiding jargon please do so.--Andrew Lancaster (talk) 08:22, 20 November 2009 (UTC)

It means he is extremely hesitant to remove the jargon, and keeps adding unnecessary and redundant jargon back. He doesn't realize that an outsider simply will not trudge past (also known as SRY10831.2), I had delegated all this ISOGG stuff and second names to footnotes, but he continues to revert these things, and he has a problem with WP:MOS.PB666 yap 22:35, 20 November 2009 (UTC)

To assist editors who should by all means work on this, let me summarize a few things:-

Version before editing of PB666 started yesterday did contain some of the problems noted above. (I have since corrected those.) It was actually broken into several paragraphs, but PB666 believes that Wikipedia policy is to make paragraphs long rather than short.

The naming systems commonly used for this haplogroup remains inconsistent in different published sources. Although it has not yet used much in published surveys, the most comprehensive survey of the known mutations is listed by ISOGG, and an equivalent tree is given in Underhill et al. (2009).[4] [NOTE: I have changed this section now. Andrew]

Prior to 2009 the mutation SRY1532.2 (also known as SRY10831.2) was normally used to identify what was known as "R1a", and this is also how the term R1a is most often used in publications well into 2009.

However the term "R1a" is also now increasingly used to refer to a broader family including not only this "old" R1a, but also other related R1 (R-M173) lineages which have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".

I think the biggest change by PB666 apart from making one paragraph, is in the last bit. Comparing the two in isolation:-

OLD. However the term "R1a" is increasingly used to refer to a broader family. This includes the "old" R1a and certain lineages within R1* that have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2 moves from "R1a" to "R1a1"."
NEW.However the term "R1a" is also now increasingly used to refer to a broader family including not only this "old" R1a, but also other related R1 (R-M173) lineages which have been found to share several unique mutations with R1a, including M420. In this newer system, the clade defined by SRY1532.2/SRY10831.2 moves from "R1a" to "R1a1".

Finally please note that there was at least a start of discussion about this passage here. While discussion did not go ahead, there are some opinions there about possible issues tio be considered.--Andrew Lancaster (talk) 09:03, 20 November 2009 (UTC)

Discussion requested about an apparent attempt to improve wording

I would like to ask for comments about whether the following wording change is an improvement. Even better would be help from more editors with ALTERNATIVE ideas.

  • Version at beginning of PDeitiker (PB666 editing session):R1 and R1a are "phylogenetic" names, names designed to show a position in a family tree, with for example R1 and R2 being branches of R, R1a and R1b being branches of R1, etc. The other way of naming a haplogroup is by the SNP mutations on the Y chromosome which are used to identify them, in the way that "M173" is named in R1-M173. There are also "paraclades". For example R1* men have mutation M173, but they have no other mutations which are yet used to identify branches of R1.
  • Version at end of PDeitiker (PB666 editing session): R1 and R1a are "phylogenetic" names, names designed to show a position in a family tree. Names of single nucleotide polymorphisms (SNPs) can also be used to name clades. For example, the M173 SNPs currently identifies R1. Thus R1 can also be called "R-M173". Because new mutations are discovered that can insert branches within clades, the R1 subclades may move but the SNP defined R-snp names will remain more consistent. There are also "paraclades". For example R1* are R-M173, but SNPs that might define new subclades have not been yet been identified. Definition of clades within subclades can result in the insertion of new clades and changes in haplogroup family trees.

Comments made to justify changes include following, with my initial remarks added in bold:-

  • Removed etc. not encyclopedic. Fair enough.
  • single nucleotide polymorphism as per WP:MOS [Manual of Style] capitals. Apparently PB666 did not realize he was editing within a link concerning this point. The words he mentions are not in the visible text. But OK, no big deal.
  • Removed mutations [the word], [because] redundant with [the word] SNP In other words geneticists know that all SNPs are mutations? But PB666 has said he is trying to minimize jargon and make the article accessible. For example he even argues that mentioning numbers like "7000 people tested" is too difficult for normal readers! I can not follow this logic, and I already reverted this aspect in the main article. If other people disagree with me please say so.
  • That is not the only problem they have, GA status[5]. I have no idea what this means, but this is a note PB666 inserted for one of his biggest changes. Can someone help me?
  • avoid red-linksFair enough and easily fixed, although I note PB666 linked outside of wiki when a wikipedia link is available for paraphyly, I'll fix
  • R1s position does not change so we can simply use R1[6]. No idea what this refers to.
  • Removed unnecessary fragment [7]. This apparently refers to the explanatory words (which are not a fragment by normal definitions) ", with for example R1 and R2 being branches of R, R1a and R1b being branches of R1". Is it agreed by others that this example served no purpose?

WP:OWN clearly applies here. And Excessive bolding on talk pages is also inappropriate, some wikipedians remove excessively capitalized or bolded text from talk pages. You are becoming increasing irrational.PB666 yap 13:41, 20 November 2009 (UTC)

Gee, I have never seen a person declared irrational because of a formatting choice before. To be honest I think accusing someone of being irrational for an obviously minor thing is a textbook example of several things mentioned in WP:CIVIL? I think the same can be said about accusing someone of ownership issues based on them asking other editors for opinions. Also see WP:AGF. Anyway, is there any chance at all that you might use this talk page in the intended manner, and work as per Wikipedia policies such WP:AGF etc? I have been posting here because that is what people are supposed to do in order to discuss varying opinions about edits.--Andrew Lancaster (talk) 14:13, 20 November 2009 (UTC)

There are generally agreed upon styles that go back to the days of the USENET that are found to be indicative of combative or non-cooperative style. One is the use of Allcaps, since USENET does not have bolding. Excessive bolding here is indicative of combative behavior. The fact that you deleted an entire section in which I replaced your un-favored bullet list (in fact you reverted completely several changes) in favor of your own is clearly indicative of WP:OWN. No-one here has agreed with you regarding the use of user unfriendly rs####### tags either, and you have not justified why you are singling out the Page's two SNPs, its almost a form of name discrimination. PB666 yap 14:43, 20 November 2009 (UTC)


When you decide to WP:refactor your comments I will respond to them.PB666 yap 15:01, 20 November 2009 (UTC)
Fine. Sorry about the bold type. Now, concerning the article, I raised some points, and I was wondering if you would discuss them?--Andrew Lancaster (talk) 15:44, 20 November 2009 (UTC)

Another request for comment about proposed rewording

I would like to ask for comments about whether the following wording change is an improvement. Even better would be help from more editors with ALTERNATIVE ideas.

  • Version at beginning of PDeitiker (PB666 editing session):R1a1a (old R1a1) is defined in various articles by M17 or M198 (two mutations which always appear together so far).
  • Version at end of PDeitiker (PB666 editing session):M17 or M198 currently define as R1a1a (old R1a1) each used as a marker identifying the same clade in different publications. These two SNPs always appear together.
  • Version at beginning of PDeitiker (PB666 editing session):Such lineages make up the dominant majority of all R1a, and most statistical or other analysis is by definition focused upon it.
  • Version at end of PDeitiker (PB666 editing session):These two SNPs always appear together. R1a1a is the dominant within the R-M420 clade, and most statistical or other analysis is by definition focused upon it. [2]

The main changes were done with no edit comment at all [8]. Is this an improvement?--Andrew Lancaster (talk) 12:30, 20 November 2009 (UTC)

New versions of the first sentence mentioned above...
  • R1a1a (old R1a1) is defined in various articles by M17 or M198. (These two mutations which always appear together in studies so far.)
Still hoping other editors will make comments and edits still.--Andrew Lancaster (talk) 14:06, 20 November 2009 (UTC)

Should a major defining mutation name now be COMPLETELY REMOVED from the article mainspace

A major defining mutation in R1a has two names, both of which are commonly used ALONE, in major articles including articles passed around by testing companies to amateur genealogists to name one type of readership. This is confusing. But somehow the article needs to handle it. Of course I can understand that the article should not mention both names every time, however, after PB666's last session I notice that one of the two names is entirely removed from the main article is now only mentioned in a footnote and in an infobox. Is this really the ideal situation? It strikes me that any term which might actually be a common search term that people might use when looking for this article should always be mentioned in the main space of the article?

Comments please.--Andrew Lancaster (talk) 12:30, 20 November 2009 (UTC)

For now I have inserted it ONCE, in the special section on this subject: http://en.wikipedia.org/wiki/Haplogroup_R1a_%28Y-DNA%29#R1a1_.28R-SRY1532.2.29 --Andrew Lancaster (talk) 13:18, 20 November 2009 (UTC)

titles of sections about major R1a clades

Although PB666 has made numerous remarks about the need to make sure we use a standardized naming system for the clade names, I note he has now twice tried to put the alternative clade names in ALONE as the titles of the sections on the three main clades of R1a. See [9] for the most recent reversion. This would mean that the main naming system used throughout this article and indeed everywhere else, would be dropped, taken out of sight even, just for those sub-section titles. An explanation would be required I think?--Andrew Lancaster (talk) 14:02, 20 November 2009 (UTC)

I noticed you deleted my section R1a1a clades even though the MOS guide clearly disfavors the bullet list style. From your point of view its about have a longer title than I think is warranted, In addition since there are two R1a, two R1a1, two R1a1a, it is better to use the unambiguous title (stated in the MOS as to be avoided) since we went through all the effort to define it. I want you to justify why you are deleting material advocated by the WP:MOS in preparation for the GA review. If you cannot I will revert everything to my last edit.PB666 yap 14:49, 20 November 2009 (UTC)
Wikipedia:Wiktionary#Wiktionary

PB666 yap 14:55, 20 November 2009 (UTC)

At some point are you going to stop going over the rail as I try to get the article to comply to wiki guidelines?PB666 yap 14:56, 20 November 2009 (UTC)

Thanks for writing something but which Wikipedia guidelines are you talking about please? I can not match any of these remarks to edits...

  • I did not reinsert bullet points. I am the one who converted the bullets to sub-section, at your request.
  • I did not revert to the longer previous versions of the sub section headings. I made them as short as possible within the AGREED principle of keeping a logical and consistent naming system.
  • I did not "delete" any sections, or anything else. I changed some things. I explained all changes.
  • I did not make anything ambiguous. I think everything I did was clearly and obviously aimed at reducing ambiguity.
  • I am not part of any project to prepare for any GA review which you keep mentioning. I am just working as a Wikipedia editor, and Wikipedia has no WP:DEADLINE
  • I have not made any arguments that we can not link to sister wikis as a policy. I just mentioned that I found a better article to link to. Check the two options perhaps?

Especially your accusation of me "going off the rail" requires some sort of justification. WP:AGF--Andrew Lancaster (talk) 15:42, 20 November 2009 (UTC)

Some of these are incorrect and some are completely false.
There can be no doubt, you clearly have a problem complying with Wikipedia guidelines. If you cannot comply with wikipedia guidelines please stop editing.PB666 yap 16:38, 20 November 2009 (UTC)
"*I did not reinsert bullet points. I am the one who converted the bullets to sub-section, at your request."
This is a false statement: you did indeed remove my WP:MOS edit and replaced it with your previous version.PB666 yap 16:38, 20 November 2009 (UTC)
Thank you for providing that diff which clearly shows no bullet points. I just did exactly what I explained I was doing, standardizing the nomenclature to the standard version, which is in fact according to a principle we seemed to agree upon. Is there some sort of misunderstanding here?--Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)

My version
M17 or M198 currently define as R1a1a (old R1a1) each used as a marker identifying the same clade in different publications. These two SNPs always appear together. R1a1a is the dominant within the R-M420 clade, and most statistical or other analysis is by definition focused upon it. This clade also has some sub-clades of its own, although a large proportion of R-M17/R-M198 has however not yet been categorized into branches defined by mutations, and is therefore referred to as R1a1* (old nomenclature) or R1a1a* (new nomenclature). SNP mutations understood to be always occurring with M17 and M198 include M417, M512, M514, M515, and rs34297606.[1]

====R1a1a subclades==== So far, 8 sub-clades of R1a1a are known, R1a1a1 to R1a1a8. However only three subclades are so far known to have significant frequencies, R1a1a3, R1a1a6 and R1a1a7. R1a1a3 was first identified as R1a1c (old nomenclature) and is defined by the M64.2, M87, and M204 SNPs is apparently rare, found in 1 of 117 males typed in southern Iran.[6] R1a1a6, defined by M434, was announced in Underhill et al. (2009). M434 was detected in 14 people (of how many tested) from Pakistan to Oman and is likely to reflect a recent mutation that took place in the area of Pakistan.

The largest defined subclade of R1a1a is R1a1a7. R1a1a7 is defined by M458 and was first described in Underhill et al. (2009). M458 is found primarily Europe (What about north America?), with its highest frequencies in Central and Southern Poland. R1a1a7 has its own subclade, defined by the M334 marker.

Was reverted by you back to this:

====R1a1a (R-M17 or R-M198)==== R1a1a (old R1a1) is defined in various articles by M17 or M198 (two mutations which always appear together so far). SNP mutations understood to be always occurring with M17 and M198 include M417, M512, M514, M515, and rs34297606.[1] Such lineages make up the dominant majority of all R1a, and most statistical or other analysis is by definition focused upon it. The vast majority of R1a1a has not yet been categorized into branches defined by mutations, and is therefore referred to as R1a1a*. However, this clade also has several known sub-clades of its own. So far, 8 sub-clades of R1a1a are defined, however only three subclades are so far known to have significant frequencies.

  • R1a1c (old nomenclature) or R1a1a3 (defined by M64.2, M87, and M204) is apparently rare, found in 1 of 117 males typed in southern Iran.[6]
  • R1a1a6 (new nomenclature, defined by M434) was announced in Underhill et al. (2009). It was found in 14 people from Pakistan to Oman and is likely to reflect a recent mutation that took place in the area of Pakistan.
  • R1a1a7 (defined by M458) was announced in Underhill et al. (2009) and is the largest sub-clade found so far. It is found almost entirely in Europe, with its highest frequencies in Central and Southern Poland. Part of this sub-clade is further distinguished as R1a1a7a (defined by M334). From 3667 tested samples taken from 60 Eurasian populations, Underhill et al. (2009) found only the following:-
Oh those bullets. Until recently there were more important bullets in this section which was the focus (I understood of concern) and I converted those, in response to your concern. Concerning these smaller bullet points, I did indeed re-insert them. I think they work better than your version. If you think not, say why, without referring to some person or "rule" you do not represent any more than I do. Sorry for the misunderstanding though.--Andrew Lancaster (talk) 22:38, 20 November 2009 (UTC)
When you revert edits it is your responsibility to observe what you are reverting, to do otherwise creates havoc. As for why, find a featured or good article with bullets thrown around, or the table, as you have placed it under the bullets. Once done you need to give the good reason for having it instead of proper text.PB666 yap 22:44, 20 November 2009 (UTC)
I clearly did know I put those particular bullets back in. I was confused by your talkpage description of what your concern was.Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)
SO you admit you lied, and not its my fault you lied. Andrew, do we need to take this to arbitration? Again these types of behaviors are consistent with WP:OWN
Please do take this to arbitration if you think it is the right thing to do. You also recently implied that that I should be banned from Wikipedia. Did you mean it? If you meant it then do something. Please stop saying stuff like or indeed, please put your money where your mouth is and go make your case. I think the posting I am replying to can be one of the exhibits. Will you do it? Here's what I bet: you will not respond to this, but you'll keep making personal attacks claiming that I am a bad faith editor. And your will do this instead of working towards a better article, as a diversion. This has been your way of writing since your unilateral article split was botched and reversed.--Andrew Lancaster (talk) 12:58, 21 November 2009 (UTC)
Then you would bet incorrectly. I have put this issue of Sophian/Small Victory is to try to get you to realize that you are doing the same kinds of things which you did not like them doing. And again if its destructive to the evolution of the page you need to come to realize this. Way back, when I was asked to offer an opinion on conflict of interest I took your side, but at the same time I examined the variety of edits to the E1b1b page and found alot of the most 'disturbing' edits from an encyclopedic point of view, many of these edits were yours. I was forced to stop what I was working on and try to repair an extremely unencyclopedic page. I did not single out all of your edits but because maybe you did not have much of an edit history, but at some point you need to move forward from an entry level editor, to someone who has more focus on the goals of the encyclopedia. Again, if I have a molecular anthropology background and have difficulty reading Y_DNA pages, it means that the page has serious problems. Many of these pages do, not only edit warring that is going on, which are indefensible, but what high-level page editor for wikipedia is going to defend the pages, they are written in their totality, as you say, 'a dog's breakfast'. This process may be painful to you, however at some point I will make no more edits to any Y-DNA, I will not arbitrate discussions. The only pages I will work on are basic pages, for example Y-Chromosomal Adam and Haplogroup A and Haplogroup B pages because of their importance. You have an interest in E1b1b page, wouldn't you like to see it be promoted, maybe become a featured article that will be seen by millions of people, instead of the 200 or so folks a day? Its never going to get their if you do not make quality improvements.PB666 yap 16:09, 21 November 2009 (UTC)
No, I bet correctly. You have not responded in any direct, clear, honorable or WP policy-guided way (make your accusations clear, or else drop them) and you have continued to write ad hominem, i.e., not saying justifying your edits in terms of quality or lack of quality, but for example in terms of how you claim to be qualified to put me through difficult editing experiences in order to educate me. (Where do you get that from?)
Your non-response concerning your accusations clearly also shows that you see no problem with making false statements about people in order to make a point - implying that I should be banned from Wikipedia is now explained as a way to get me to realize things.
Your behavior is wrong simply, but also totally in opposition to Wikipedia norms.--Andrew Lancaster (talk) 16:43, 21 November 2009 (UTC)
Tell you whats goig to happen now Andrew, I am going to make the changes I think are appropriate to the page, if I see you making major reversions or WP:OWN edits I will simply take the case to arbitration and we will draft this discussion into the evidence. Is that OK with you?PB666 yap 11:35, 21 November 2009 (UTC)
The diff you pointed to and all previous discussion seemed to be implying that I reverted the creation of sub-sections from bullets which you demanded. My initial responses to you and requests for diffs also show this is what I meant. I think it might not be obvious to others that the discussion now obviously looks odd, because you wrote your more detailed response after responses to your response had been written - as per my complaints about your talkpage habits on numerous occasions. Coming back to the supposed point, MOS does not forbid all use of bullets, does not say ledes must be padded, etc etc.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)
[Sighing and shaking head] Grow up. Its like I am arguing with a 5 year old. The lead does not fit the criteria as a stand alone synopsis of the material. I know this because I posted it on the Molecular Anthropology portal and IT STUNK. As a result I added a minimal amount of structure to make it stand alone. You are obviously wrong on this issue, what you need to do is to go ask someone who has edited many good ledes what is wrong with the lede on this page, since you don't want to take my word for it. No more arguing Andrew, I am going to change the article and if you repeat what you did yesterday then the case is going directly to arbitration.PB666 yap 11:35, 21 November 2009 (UTC)
You appear to be saying that the GA reviewing means we need to write not according to what make an article really good, but according to more formal rules which make even make presentation worse.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)
This is an encyclopedia, it is an electronic encyclopedia. It is not a review article in Current Opinions in Bovine Excrement. What makes an article good is to assemble the article according to the guidelines so that Wikipedia has consistent standards. Once an article is marked as a good article it is translated to many other languages, distributed on other media, etc. IOW you have to compromise in order to get a validation that allows more people to see it.PB666 yap 11:35, 21 November 2009 (UTC)
That seems to confirm then, that you see GA standards as a compromise with article quality. I am not interested in GA standards if that is true. (It obviously is not supposed to be true.)--Andrew Lancaster (talk) 12:58, 21 November 2009 (UTC)
Andrew, you are being pedantic, this is not primary literature, its not a human genetic workshop. The venuw is that it is a general purpose encyclopedia. You need to read WP:NOT

[enormous quotation of WP:NOT posted by Pdeitiker and deleted by Andrew Lancaster]

If this is true, then I choose not to aim at the later standards. I'll stick to real quality instead of GA review quality. If GA standards are really so formalized then I guess there is a chance that no haplogroup article will ever be seen as a top level article, which does not bother me at all. I guess there are a number of Wikipedians who think haplogroups are scientific arcana and do not even deserve to have Wikipedia articles.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)
  • Then you diminish wikipedia. The standard is it an encyclopedia. It is rather open, but you cannot force upon the page unencyclopedic information and say I will fight to keep this (what ever your cherished terminology or jargon is), and revert others who attempt to make it more encyclopedic. If you are clever you would say, I can compromise on this, I will explain the terminology I essentially need, I will limit the terminology to only the essential stuff, the other stuff I will note, and I will try to draft as many readers into my favorite subject, instead relying on those geeks out their who for whatever reason like to understand new and highly complicated lingo. Some of those geeks, not so well rounded, would like nothing otherwise than trash your page, and since you have so few broad wikipedians who will engage your page, then were will your page defenders be? Why did you join Wikiproject Human genetic history if you intent was not to make it more encyclopedic? Sounds to me like a contradition.PB666 yap 16:38, 21 November 2009 (UTC)
You know very well that I simply disagree with what you say that Wikipedia policy says and means. I also disagree with you concerning your personal judgement of your own ability to judge any type of writing style including the "encyclopedic" one. There is therefore no point talking as if the disagreement is based on anything else. That is a waste of time.
Your insistence that people should treat your word as gospel if they want to communicate with you (even though your knowledge this subject is dodgy, and your writing terrible) has managed to convince no one, and I think your (fake) threat to call in arbitration would be one way to get a broader perspective on how unusual your opinions are. But actually you know already how weak your case is, or else you could make your case in a clear and consistent way.
How weird is your position? Let's see. You say your latest edits and positions were about removing and reducing jargon and yet we see...
  • Changing sub-section titles to use a nomenclature different from all the literature and the body and title of the article (in direct contravention of discussion which has been had on this exact matter of the years at WP:HGH). Y
  • You changed the jargon word "family tree" to the common everyday word "phylogenetics". :)
  • "region specific distributions" - couldn't find a normal way to say it?
  • "evolved from a male-line ancestor who was in haplogroup R1" replaced by the much simpler (not) construction "R1a evolved along a Y-chromosomal lineage (a male or paternal line of ancestry) from haplogroup R1" (you did at least explain your argument that "male line" is jargon.)--Andrew Lancaster (talk) 17:40, 21 November 2009 (UTC)
"*I did not revert to the longer previous versions of the sub section headings. I made them as short as possible within the AGREED principle of keeping a logical and consistent naming system."
Again this is a false statement, you have not read the guidelines. The naming guidelines with titles and sections that are pertinent are:
  • Titles should be short—preferably fewer than ten words.
  • Change a heading only after careful consideration, because this will break section links to it within the same article and from other articles. If changing a heading, try to locate and fix broken links.
  • Special characters—such as the slash (/), plus sign (+), braces ({ }), and square brackets ([ ])—are avoided . . . | |WP:MOS
Again, thanks, but this time you provide no diff. Therefore I will simply note what I can...
  • I did not make any titles with anything approaching 10 words. All were short by any standard.
  • I gave careful consideration, and explained my edits both while editing, and on this talkpage, starting this discussion which you are now in.
  • I did not insert, but I did in fact remove, some unusual characters. I can use the same diff you gave: [10]--Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)
I believe you should also back your accusation up that I did supposedly "revert to the longer previous versions of the sub section headings". Please give a diff or diffs showing the reversion to the old versions.--Andrew Lancaster (talk) 18:05, 20 November 2009 (UTC)
The reason I changed the section headers is quite simple, as you outlined in the above paragraph, one set of names are subject to change, this will cause a disruption of wiki-links if it occurs. As this required the use of a second set of names, which you justified, wikipedia prefers the section names that will be most stable. Once we get established section names we do not want them to change.PB666 yap 16:38, 20 November 2009 (UTC)
See the start of this talkpage section where I have explained things. The most common names used everywhere are the phylogenetic names. It is also how other articles and this article are written on Wikipedia. I personally always tend to use the mutational names in correspondence, but I do not force the article to follow my personal habits. I find it striking how much you are in conflict with your own talkpage remarks here. For example: "R1-M173, R-M173 and M173 are used on different occasions, use only one terminology." [11]--Andrew Lancaster (talk) 17:46, 20 November 2009 (UTC)
"I did not "delete" any sections, or anything else. I changed some things. I explained all changes.
Another false statement: see above. You need to start paying better attention to what you are doing. If I had split off R1a1a article the article would be done now and in compliance with WP:MOS, you are simply creating the need for more edits and more reorganization because you refuse to read the MOS. Get your act together!PB666 yap 16:52, 20 November 2009 (UTC)
"See above" where please? Please give a diff for what I deleted.--Andrew Lancaster (talk) 17:16, 20 November 2009 (UTC)
You have given no justification for adding the rs###### style in these two instances other than your preference and your discrimination against Page's last name, it clearly adds more unnecessary and more complex jargon to the page, it disrupts the cladogram making it much less professional looking relative to the pre-2009 cladogram, and it introduces a level of jargon that is covered by three other levels, Rx, R-M###, and M###. In addition your meddling with the cladograms has thrice screwed up the formattin which I have had to repair. You obviously don't know how to work with templates, and yet you insist on making changes that make them less professional. It is clearly not either neccesary or encyclopedic. Underhill, a professional, made the choice in the figure as to which was most appropriate to public consumption, he deligated the rs###### to the supplimentary material. Why do you think your judgement is better than his on the issue? You clearly have a 'special' problem with the label, but you cannot provide any support that it is mislabeled. Again WP:OWN issue here.PB666 yap 16:52, 20 November 2009 (UTC)
To answer your multiple points here (it would be great if you could stick to one thing at a time, I have tried to make it easy):-
  • I did give justification for the rs mutation name. See [12]. You have been extraordinarily unclear in your responses, to put it mildly.
  • rs reference numbers are standard and this particular one is cited in several articles.
  • Despite what you say, Underhill et al. also uses it, as you know. It is not true to say those authors chose one name over the other. In one paper they used the standard name and an unusual name. In other articles the same authors use only the standard name.
  • Concerning my bumbling on the cladogram, sorry. However I asked you to fix it [13] because it was showing R-M420 as a parallel clade to R-SRYSRY1532.2 and you refused, which represents no past, present or future proposal of anyone. Eventually we got it right though.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)
My edits were in compliance with WP:MOS. your reversions were not.PB666 yap 16:38, 20 November 2009 (UTC)
Without going through the rest of the issues, even after giving you a suitable draft your new sections:
  1. were not logically organized (See your talk page),
  2. continue to rely on material that will be critiques during review (list of fractions in text, list of mutations in text, non-compliance with a naming standard rs#######),
  3. had colloquial (non-formal, non-professional) wording,
  4. and etc.
If you do not start following the MOS I will simply revert your edits back to my last edit. Your edits are clearly exemplary of WP:OWN because you do not want review the guidelines before making edits and/or reverting edits and will be a stumbling block for GA review. You must familiarize yourself with WP:MOS in progressing further until you do so further discussion here is futile. Am I making myself clear?PB666 yap 16:38, 20 November 2009 (UTC)
In all honesty I struggle to find any case where you have been able to define any edit of mine as against the Manual of Style.Andrew Lancaster (talk)
Then you should probably stop editing and reverting peoples edits and read the entire WP:MOS. I assure you that the referees have read MOS. Whether or not you struggle is irrelevant, you have reverted edits based on MOS recommendations and you are not acting in good faith in defending those edits.PB666 yap 21:21, 20 November 2009 (UTC)
Please stop speaking on behalf of people who you are obviously not speaking on behalf of. If YOU say I should do something better, then YOU should explain it in your own name.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
I note that you have switched to referring to MOS as more or less yourself in third person, just as you have recently been referring to the GA review process as yourself in third person, and previously it was the grading process to which we all had to defer when accepting your opinions. Andrew Lancaster (talk)
This is a transparently deceptive statement. While I am trying to get this page ready for external critique,(the best way is to go over WP:MOS guidelines) this is the best defense that you have for your actions. Please cease. Your edit of the cladogram is clearly a POV edit.PB666 yap 21:21, 20 November 2009 (UTC)
Well, as you keep saying, I may also be irrational. But I did my best to explain my thinking and ask you to explain yours. That's all any of us can do. It is much less than you did.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
Referring to yourself in third person, or making up imaginary authorities, is sometimes a way to avoid normal discussion. I think it is important that you avoid that temptation.Andrew Lancaster (talk)
Another clearly diversive remark. Once nominated articles will be reviewed, it takes about 8 days for the process to begin, OK. I have no involvement in outside review, you appear to be unfamiliar with the process for improving wikipages beyond a certain point (that would be start class it appears). The person who might review this page has already left a comment on this page, 'too much unexplained jargon'. PB666 yap 21:21, 20 November 2009 (UTC)
Although I do not care at all about any review you have asked for, it sounds like we'd probably both agree with him, which would imply that we should work on remedies. So what is your point? You seem to be saying that you have inside knowledge to say that this comment was specifically directed at something I wrote or which I defended? Or what exactly is your point?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
In contrast, concerning your proposal to revert all my edits, this sort of thing happens on Wikipedia and as you know there really are procedures and rules which come into play and take over from our conversation. If that is where you are headed then I find that unfortunate.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)
I am giving you ample opportunity to make the requested corrections in your own words. Since you are here arguing with me then it indicates you desire not to make the change and therefore justifies the reversion. Simply stated you are acting in abstinence to the guidelines.[User:Pdeitiker|PB666]] yap 21:21, 20 November 2009 (UTC)
That is "simply stated" as only you could simply state. I am in abstinence now of understanding what you mean. What are you talking about? Aren't you complaining strongly about the fact that I have been editing in my own words? Haven't you been reverting me and going to extraordinary lengths to stop me doing this?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
I would also like you to demonstrate your good faith and back-up the rest of your above assertions that I was being "incorrect" or "completely false" in my above summary. The points you have not explained:---Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)
Did you not look at the diff. Clear as day, I converted your bullet list into a new section and you reverted my edit, back to the bullet list. No reasonable explanation was given, not attempt to merge your edits into my edits. This is something I would expect of Small Victory or Sophian. This is a 'lack of good faith' reversion, and on top of that you've now lied about it, and you are pretending it did not happen? Right now the only difference between you, Sophian and Small victory is that they have been banned and you have not.PB666 yap 21:21, 20 November 2009 (UTC)
Can you please have a look at the diff you quoted then and make sure you picked the right one?--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
  • You apparently claim that I made the sub-section headings ambiguous. Please give a diff.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)


Again another false statement, I did not singly claim you made them ambiguous I claimed that they were not in best compliance with Wiki guidelines, 'Short as possible, free of special characters as possible, and section heads least likely to need later revision'. What I stated is that the section heads should be about topics in that section, since some section refer to old R1x in one section and new R1x in the other section that was more ambiguous than the carefully defined (finally) R-M### names. These names are therefore preferred, well defined, unlikely to change in the future, reasonable short, needing only one special character, a "-". This makes internal and section linking the easiest and most reliable. In mentioning what you said about R-M clades on my talk-page and on this page (in quotes) that '100s of undetected mutations' you, yourself, admit that these section heads may change in the future. I personally don't like 'E-M123' terminology, however they best fit the WP:MOS#section and since they best fit WP:MOS it is my opinion that these are the only headings that should be used. At some point are you going to stop misrepresenting things I said and start improving the page?PB666 yap 21:21, 20 November 2009 (UTC)
  • You apparently claim I was lying about not being "part of any project to prepare for any GA review which you keep mentioning" and/or about the fact that "I am just working as a Wikipedia editor, and Wikipedia has no WP:DEADLINE". Please explain what that accusation means. Should be good.--Andrew Lancaster (talk) 17:33, 20 November 2009 (UTC)
If you are going to use WP:DEADLINE as an excuse for reverting edits that are compliance, improvement toward MOS guidance, knowing that these issues are going to be the focus of the review then I would say you are acting in bad faith. Making false statements saying you did not do it, then it is certain you are acting in bad faith.PB666 yap 21:21, 20 November 2009 (UTC)
  • You also apparently claim that I have arguments that we can not link to sister wikis as a policy. Or perhaps you are claiming my lie is to say that I just mentioned that I found a better article to link to.
The diff was already provided above. Explain why you made these reversions? A and B.PB666 yap 21:21, 20 November 2009 (UTC)
PD, are you going to repair the above so that it can be read and responded to? I was writing responses when as so often I found you'd come back to de-construct your own work so much that it can hardly be read.--Andrew Lancaster (talk) 22:06, 20 November 2009 (UTC)
Haven't you learned yet how to merge edits?PB666 yap 22:11, 20 November 2009 (UTC)
That's not the point. You've created a dog's breakfast above. If I insert answers and make it more complex no one including us will ever be able to read it. What is that quote now doing hanging in the middle of everything? And an even bigger problem is your habit of continuing to edit your remarks after they have been responded to. Most people do not post so many layers of "draft" over such a long period as you do. As a person responding I therefore need to at least know when you've stopped changing your mind and come up with your "real" response. In frustration at your lack of simple courtesy I do now insert responses above.--Andrew Lancaster (talk) 22:31, 20 November 2009 (UTC)
You did the same thing on the main page, I had to merge edits on three occasions and after all of that you reverted it. Good for the goose, good for the gander. Are you going to respond to Marmaduke's critique of unnecessary jargon?PB666 yap
I see no connection between the two things. On a talkpage it is obviously a major aim that your formatting should allow people to see how a discussion develops. Inserting new explanations after old ones have already been answered, or signing them days later, is just obviously wrong. When editing articles themselves the main aim is making the article better. The biggest problems we are having there is that you make very little effort to write carefully, or read the structure and context of a section where you are writing, even though a large % of your edits are supposedly copyedits. I do not believe our editing style is the same in this respect. Concerning Marmaduke's comment are you referring to the one I already replied to at length, and where you have already posted a sarcastic rejoined? What is your point, if any? I'd say the point is that normal editing is being held up and confused by numerous issues arising from your constant demands that we must obey your strange interpretation of the MOS (padded ledes, no bullets at all, no numbers etc) or else you will start making massive unilateral changes that will need to be cleaned up.--Andrew Lancaster (talk) 07:24, 21 November 2009 (UTC)

Table issues

I have added two tables and Andrew has added one table to the page. There are problems. The table comparing STRs which I have added, and STR are discussed in the aspect of diversity, but no description of STR have been added to the page.

The Table Andrew has added needs to be improved for readability, if he doesn't mind I will improve it. I can inprove according to the standard wiki-table style or the style of my other tables.PB666 yap 15:40, 21 November 2009 (UTC)

If you improve a table why would I be against that? If there is something about the improvement that others might think makes it worse, then of course you could explain about that.--Andrew Lancaster (talk) 16:00, 21 November 2009 (UTC)
When I make a table I have a final style in mind, I don't know what you have in mind? you can correct some of the problems yourself. If you specific the border style, you need to then specific a width to separate out the columns. It is relative simple to insert at the top row of each column width = 40px (or whatever number of pixels provides the best fit)

Major re-write of phylogeny and other sections needs feedback

Rather than continuing a circular discussion, or taking up the gauntlet of Phil's edit war invitation, I'd like to call for other editors to now take over this article.

I did a lot of edits on this article in recent times, and was then stopped (before I think the job was finished) by a stream of complaints starting with a complaint that I and another editor objected to a proposal to try to discuss R1a1 and R1a1a in two different articles. Discussion, as you can see on this talk page, took up a lot of time, but failed.

Now PDeitiker has, as threatened, taken over and done a large number of edits in directions he knows that the other editors active on this article disagree with. We seem to be moving further apart, and that's why I call in others.

This history means it is luckily easy to post a diff for two proposed versions, which can be easily compared, and perhaps merged, or else one can be chosen over the other, or whatever: [14]

Most of the differences and disagreements reflect format and wording issues, and the question of "what is encyclopedic?" Please other potential editors, note that what is needed right now is judgement on formatting and wording, not on the details of the science (although in some cases, the right wording or formatting might require some knowledge). The publication of two recent articles on R1a was perhaps a trigger for all the work that led to this situation, but most integration of the basic facts is done (although of course this can still be improved also.--Andrew Lancaster (talk) 15:55, 21 November 2009 (UTC)

I think that would be appreciated at this point. PB666 yap 16:46, 21 November 2009 (UTC)
I think a diff of each of the proposed versions would be very helpful for editors who are now joining the discussion. --Athenean (talk) 19:42, 21 November 2009 (UTC)
Since his posting this morning, I have made some improvements both in the text and also improved Andrew's table but have some questions I left in the text for him that he can repair His last version versus my last version and I really appreciate some review, thanks.PB666 yap 19:58, 21 November 2009 (UTC)
It could look half as good as either version and still look supremely superior to Haplogroup R1b (Y-DNA). As far as this and that I favour as much explanation as possible for those learning, including long section titles for those who might be easily overwhelmed and need to keep going back to the top of the page. DinDraithou (talk) 23:12, 21 November 2009 (UTC)
Thank you, since this is the first Y-article to challange at this level, keep in mind that the concepts and structures we use here may be precedences for reorganizing that page. This is mainly for Andrew's benefit, because I will not take part in the process of elevating that page. IOW, looking at that page and given all the times that the phylogenetics has been redone, should we fix headers based on fashionable names or the defining mutations. Or to place it in another perspective, given the problem is wikilinking, should we take a risk that the number of wikilinks to those section heads will be few. Another alternative is to post a hidden warning about wikilinking to the sectin heads, that these are subject to change in the future.PB666 yap 23:44, 21 November 2009 (UTC)
DinDraithou, if you have two good versions to choose from then it should be relatively easy to make improvements. (R1b is indeed still at another level, but it is also an even more difficult subject.) Wikipedia is about making any improvements, no matter how small. As long as you do not mix styles so much that you create a structural problem editors can use these two versions to pick and choose. Also note Deitiker's idea that his changes represent what should happen on other articles, so people should comment.--Andrew Lancaster (talk) 13:18, 22 November 2009 (UTC)
The solution to R1b page is divide and conquer, There is a single SNP, P310, that divides modest expansions within the tree from a point of radiation, within the R-P310 subclade there are two major branches R-U106 and R-P312 subclade that have a pattern of radiation comparable to R-M17 in R1a. Therefore, if one was clever they could break up the article into a section dealing with the basal branches, A simplified cladogram of the basal branches. Then they could deal with the R-P310 clade two major sections for the subclades. Its not that difficult, unless of course someone with a new publication completely reorganizes the family tree.
This is what the R1a article looked like, [15], if that mess of facts and inappropriate quotations can be fixed, so can R1b.PB666 yap 16:36, 22 November 2009 (UTC)
Another point of view This is all hard work, there is no doubt about it, but even recently reviewed pages like E1b1b and E1b1b1a need alot of work on the explanation and dejargonization category. We may even want to create a page on Hg-SNP naming system so that it can be explained in one placed and wiki-linked, including places where it is superior, inferior, unknown potential and all of that. If one thinks the situation with R1b is bad, take a look at Haplogroup A (Y-DNA) and Haplogroup B (Y-DNA) for instance, some clades, very deep clades have almost no defining mutations less than 1 in 30 defining mutations have been detected at all levels within the clade. Hopefully there will not be many people that have this haplogroup and the bushiness of the undetected is low.PB666 yap 16:51, 22 November 2009 (UTC)


If anyone wants to do a test, go see how many phylogenetic names sections for Y-DNA pages are wikilinked directly. If the answer is zero or very near zero then I don't see a problem with Andrews dual name section heads.PB666 yap 23:54, 21 November 2009 (UTC)
What do you mean by wikilinked "directly"? If you are asking whether the articles, texts of articles, and links to articles use mutational or phylogenetic names, I already told you and you already know. Above [16], you seemed to be saying that you were out to make edits which would teach everyone painfully that Y haplogroup articles are all written with an un-encyclopedic style (specifically including this subject of these heading titles) so you know very well you are working against everyone else. Anyway, shouldn't you, the person proposing the change, be making the case and not telling everyone else to go and double check one more time? By the way, this subject has been discussed many times on the relevant wikiproject, before you joined it perhaps: WP:HGH.--Andrew Lancaster (talk) 13:09, 22 November 2009 (UTC)

There is still one bullet list in the article that needs to be broken down into paragraph form. I believe that section needs a better lede.PB666 yap 14:35, 22 November 2009 (UTC)

I have to agree that there aren't any real substantive differences between the two version. Disagreements seem to be about presentation, prose and semantics. This paragraph appears to be more complex than it needs to be. Apart from the aforementioned paragraph, my initial impression is that both versions would be acceptable, especially when compared to typical wikipedia articles. Wapondaponda (talk) 17:40, 22 November 2009 (UTC)
Yes, wording and formatting etc is part of the work involved in making a good article. Please make changes or comments based on what you think works best?--Andrew Lancaster (talk) 20:08, 22 November 2009 (UTC)
He did, and the paragraph, at least the first sentence had already been change, for some reason he was using an older version. Even so, I will see if I can simplify even more, cause that is what consensus building is about. I wouldn't worry to much about versions, there are 25 or so Y-pages you will have the fullest opportunity to correct,and the referee hasn't given an opinion yet, there is lots more work to be done, and the section is likely to change, I suspect, in some big ways.PB666 yap 03:13, 23 November 2009 (UTC)

Reality and scientific view

The most recent publications on R1a have increase the known complexity of the R1a clade. It seems to me that this statement confuses the reality with the scientific view. The real clade is not changed by scientific publications. (Also wrong tense in increase.) --Ettrig (talk) 08:48, 22 November 2009 (UTC)

In order to see the intention it might be best to compare my last version before PB666's major rewrite [17]. (His rewrite was aimed more encyclopedic tone, in his judgement.) From these two versions maybe you can choose one or make a new one, or else, once you know what it was meant to say, you can perhaps make a case that it is wrong or unnecessary. Of course for things like obvious spelling errors etc, please just fix them everyone.--Andrew Lancaster (talk) 13:00, 22 November 2009 (UTC)
Agreed, the sentence needs to be tweeked.
Actually we don't need the word most, because soon these will not be the most recent.
  • Recent publications on R1a have uncovered more complexity within the R1a clade.
  • Recent publications on R1a have disclosed more complexity within the R1a clade.
  • Recent genetic research on human Y-chromosome has detected more complexity within the R1a clade
  • Recent human Y-chromosomal research has highlighted more complexity within the R1a clade
  • Recent human Y-chromosomal research has highlighted that there is more complexity within the R1a clade
  • Haplogroup R1a investigators have discovered more complexity within the R1a clade
  • Recent human Y-chromosomal research has illuminated the complexity within the R1a clade
  • Recent human Y-chromosomal research has highlighted weakness in older family trees of the R1a clades, finding evidence of new branches.
  • Recent research on human Y-chromosome diversity uncovered hidden complexity within the R1a clade

And of course we could go for the first grader. Recent research on Y-DNA found the previous research to be doggy poo. :^).

Breaking this into two sentences. Recent publications within the Y-DNA research field have been intensely focused on discovering new defining mutations for better family trees. This research has highlighted new complexity with the R1a clade.

Breaking this into the type of disclosure that I wanted:
Unlike work on human mitochondrial DNA, only rarely are Y chromosomes thoroughly sequenced. Consequently, points of variation in the genetic code, called mutations or single nucleotide polymorphisms (SNPs), have been overlooked. This has caused distortions of the Y-chromosomal family tree.[7] Recent efforts have been focused on detecting these hidden polymorphisms and have uncovered more complexity within the R1a clade.[8]

IMHO. The article has been shortened enough, and I know of at least a few areas where we will be asked to shorten it more, so that expanding things that might be a little to complex for unfamiliar readers is not a problem for me.

Writing Issues

[I have moved this to a new section, a synopsis from the above it that Andrew removed something, when I queried him why he denied it and then started making false accusations, when I made it blatently clear to him what his actions were this is his response. Over the past few days I have been repeating to him that his writings and behaviors were increasingly inappropriate he does not seem to comprehend these issues, in addition he has been making reversions to the main page that are inline with WP:OWN which he claims he is not doing and that he is acting in good faith, I have refactored most of the previous section except a few critiques because of his 'mea culpa']PB666 yap 11:22, 21 November 2009 (UTC)

[Andrew Lancaster, at various places:-]

I see no connection between the two things. On a talkpage it is obviously a major aim that your formatting should allow people to see how a discussion develops. Inserting new explanations after old ones have already been answered, or signing them days later, is just obviously wrong. When editing articles themselves the main aim is making the article better. The biggest problems we are having there is that you make very little effort to write carefully, or read the structure and context of a section where you are writing, even though a large % of your edits are supposedly copyedits.[18]
Although I do not care at all about any review you have asked for, it sounds like we'd probably both agree with him, which would imply that we should work on remedies. So what is your point? You seem to be saying that you have inside knowledge to say that this comment was specifically directed at something I wrote or which I defended? Or what exactly is your point?[19]

[In the first citation above, Andrew Lancaster wrote:] "I do not believe our editing style is the same in this respect".

Your right, Andrew, I am trying to make this article more encyclopedic, and you appear to be doing the exact opposite. There are two ways to hurt wikipedia. One way is to do what Sopian and Small Victory were doing, to try to push extremist views into the encyclopedia while forcing out countering points of views, or what you are doing, which is to ignore the advice of others, fail to follow the guidelines, which compounds itself by all the Y-DNA pages, and interfere with other when they do. I come back to areas I have worked on and rewrite them. I do have examples that are good articles and featured articles, many B-class articles.PB666 yap 11:22, 21 November 2009 (UTC)

Secondarily your rewriting, that I went over and reorganized was not logically constructed and had a great many error. Again black cat calling kettle black. And if you go back into the page history of this page you added to sections to the page and failed to sign them, after I critiqued on stylistic issues, you later signed those. Don't think I didn't notice these. More or less this is a diversion from the fact that you made false statements and you cannot swallow it.PB666 yap 11:22, 21 November 2009 (UTC)

[Andrew Lancaster also wrote:-]

Concerning Marmaduke's comment are you referring to the one I already replied to at length, and where you have already posted a sarcastic rejoined? What is your point, if any? I'd say the point is that normal editing is being held up and confused by numerous issues arising from your constant demands that we must obey your strange interpretation of the MOS (padded ledes, no bullets at all, no numbers etc) or else you will start making massive unilateral changes that will need to be cleaned up.[20]

That reply is inadequate, there is a whole host of jargon that is going to be criticized, you can't put one pea in a soup and call it split pea soup. And, BTW, I am not of a false belief that nothing I have added will be criticized some things may not be obvious to me, but you have many things in your writings that our obviously jargon and you are stubbornly protecting them. So the when the review is done that is what I am going to say, we have one editor, and here, Andrew Lancaster and here are the diffs, that stubbornly protects un-encyclopedic wording.PB666 yap 11:22, 21 November 2009 (UTC)

So now you are not only re-editing your comments after they are replied to, but also re-editing mine. One way or another it is clear that this conversation is going no where. You are repeating yourself and effectively your main argument is "what you say is what you are". I stand by my claims that:
  • You have consistently spoken vaguely of me breaching some sort of rule without ever being able to explain a case in detail. (The exact rules or third parties you claim to speak for keep changing.) For example here note the "whole host of jargon that is going to be criticized". Not by you, right? But by the bad cop? Why not just explain the case for your preferences case by case like other people do?
  • Who says bullets are not allowed? Cite.
  • Who says ledes must be a minimum length, and need to be padded if they are two short? Just you.
  • Who says that numbers are to be avoided in all situations? No-one. Even the rules you supposedly believe in keep changing.
  • While I would much rather simply get on with editing, I believe I have tried to explain my ideas in every case, in detail, with diffs. You have not done the same. In fact I feel some regret about having wasted time on that. Indeed, as a result, you have now even accused me of ranting and dwelling on details.
  • Furthermore your technique of quoting WP policies and MOS with your words interspersed but unmarked, plus your way of re-editing both your own talkpages remarks as well as the responses of others, is dishonest and shows that sensible communication is not possible.
I am open to communication if it seems possible in the future.--Andrew Lancaster (talk) 12:51, 21 November 2009 (UTC)

PB666, I notice you have decided to go massively unilateral again, as threatened for some time, even spelling mistakes and jargon are being re-inserted. Not one compromise to the proposals of other editors is being considered. You have indeed been saying that you are going to start edit warring soon. The reviewer you keep mentioning will no doubt be pleased with the stability of consensus of the article, which is I think one of the first things they look at?--Andrew Lancaster (talk) 13:16, 21 November 2009 (UTC)

The sections I worked on have been proofed by MSWORD grammar and spelling checker, in addition I fixed your grammatical errors also, MSWORD does not know how wrote or miswrote, also repaired broken links in the page, also fixed a number of other issues. I did alot of things, but massivel unilateral is not the case, I have more or less repaired, simplified, sometimes favoring your lingo (for example mutation versus snp) over mine, which-ever is the best suited to comply with MOS and the dejargonizing effort. And you should note that I have pointed to sections that it was in the best interest to change, but I left in your version, even correcting minor spelling an grammar errors in those sections. Now if you go in and screw it up, that is an issue I will bring up at some later point, but at least there is a diff now, so that if the referee makes alot of comments, I will simply show the diff and say, this is what Andrew changed. You have to make a choice now Andrew, are you going to evolve, or remain stubborn.PB666 yap 14:02, 21 November 2009 (UTC)
I should point out, Andrew that when pages go through the GA process, they often pick up concerned editors who will protect pages from lower quality reversions. Again, please re-edit my wording as you see fit, but please also read the MOS completely before doing so that you are lowering the quality that is there, and if you did a mindless revert as you previously did it will go to arbitration.PB666 yap 15:40, 21 November 2009 (UTC)
I should make a few points: Haplogroup is not well defined on the page. MSWORD picked it up as Jargon.PB666 yap 14:02, 21 November 2009 (UTC)
Haplogroup is indeed a type of jargon, but how do you write a genetics article without even this level of jargon. The first paragraph of the whole article explains what a haplogroup is in very simple terms unless you've changed it. MSWORD simply can't be the right standard here.--Andrew Lancaster (talk) 15:58, 21 November 2009 (UTC)
I completely agree, however the jargon we need to make sure this it is indeed explained fully. The question is, not to you Andrew is but to someone less familiar, are we doing an adequate job of explaining the jargon. We need an outside opinion for that purpose.PB666 yap 22:58, 21 November 2009 (UTC)
Your actions show you and you alone are deciding.--Andrew Lancaster (talk) 21:26, 23 November 2009 (UTC)

PB666's new "draft" for the lead (actually already put in the article)

PB666 has replaced the old lede, saying it can be discussed on the talkpage, though he has posted nothing here. It should be mentioned that his new version substantially copies old drafts and ideas he has posted before: [21], [22]. My own opinions can be found at those diffs. Two points:-

  • The basic argument PB666 has is that the lede length must be a certain proportion of the article length, and that therefore the lede has to be lengthened because of wikipedia policies and WP:MOS. This is nonsense.
  • As a result, this lead is highly redundant.
  • The effort to pad the lede with things also discussed in the rest of the article leads to some very problematic summarizing, for example the geographical part.--Andrew Lancaster (talk) 15:08, 23 November 2009 (UTC)

Please note a NEW comparison diff for my old version, and the latest PB666 version: [23]--Andrew Lancaster (talk) 15:08, 23 November 2009 (UTC)

Some people may be more comfortable looking at how the articles actually look in the two versions, see: [24] and [25]--Andrew Lancaster (talk) 15:15, 23 November 2009 (UTC)

please edit and comment where necessary, this is essential at this point to move this forward within the next couple of days. The lede draft is only placed for formatting purposes to make its size consistent with the size of ledes in article similarly size, I collected as many major facts from the article as neccesary. Here is an example of a lede within the HGH group (barely) that is a featured article. This is the type of lede which we are shooting for. My participation in these discussion is going to wane as I believe that most of the major problems with the article are dealt with in some fashion, but many revisions will be required. Homo_floresiensis, you will note Andrew, that there are many redundancies between this lede and the main article, this is done as part of the wiki-guidelines, however the desire it to use simple wording and summary style. Like the abstract on a paper but more suited for a layman. The lede should be a stand-alone summary.PB666 yap 16:16, 23 November 2009 (UTC)
One deficiency in the lede that I did not correct, the info-box is way too verbose, the lingo needs to be simplified.PB666 yap 16:16, 23 November 2009 (UTC)
Just to make sure it is on record, you know I disagree totally with this remark, which is purely your own subjective feeling, and you know you are now fully in unilateral edit war mode. The infobox and lede which you are quickly editing like a bull in a china-shop, developed slowly out of some knowledge of this clade, and the controversies around it. I actually tried to understand people. What you are doing is creating a version out of ignorance which will be unstable, and misleading. I have tried to explain, but you did not want to know [26], [27]. Why have given special status to Western India and Ireland for example? You waited for me to get this article in a stable form because you knew enough to realize it took someone who knew the subject a bit. Now, after waiting, you are jumping to try to prove you can make a polished article, as per your own explanations. I beg you to stop working in this way. Eventually this unilateral ears-closed work will require reverts, but they are going to get more complicated if we wait too long.--Andrew Lancaster (talk) 20:26, 23 November 2009 (UTC)
So Andrew only your version of the Lede was acceptable? I said it was a draft, I will further work on it and refine it, if no-one else does, and your desire to revert is very typical of your behaviors, I assure you when article review is done, many things will change including the lede. So that you can depoliticize your comments.
I want you to answer this question, why are you so against expanding the lede to contain more of what is in the article, just answer that question? What do you have against the style of ledes in other good and featured articles. This is all I am working in the direction of, if I make a few 'bull in the china shop' errors, that's fine as long as I don't assume a WP:OWN stance on the lede. I waited for improvements for the lede based on the discussion on the subpage, no changes were made so WP:BOLD. If you desire to revert those changes that is also fine, however it only means we will have less refined comments to work with when review comes about. And, BTW, when are you going to convert the bullet list you created in the Origins of R1a1a section to paragraph form? How about repairing all those references? If I correct that bullet-list are you going to have another hissy-fit and threaten to or revert it? You can send this message to the incident board also, you have my permission.PB666 yap 23:29, 23 November 2009 (UTC)
No, a bull in a china-shop approach is not appropriate at all. As usual you are calling your work in the main article a draft which can be fixed later. All editing on the main article has to be aimed at improvement, not tests. Drafts should be done in sandboxes. The same lede was put in a draft by you but you did not want to read any criticism of it, saying that it was argumentative nit picking of me to actually treat your draft this way.--Andrew Lancaster (talk) 06:31, 24 November 2009 (UTC)
This reply again is combative and argumentative, the lede was reasonable, though not perfect, the current lede of Andrew has a run-on sentence that MSWORD marked as having a syntax error. So what is a bull in a china closet is really in the eye of the one who is producing the BS.PB666 yap 14:00, 24 November 2009 (UTC)
MSWORD is not editing here, and should not be used in this way. MarmadukePercy and I both commented on your lede proposals several times and gave our comments, explaining why we disagree with your positive judgement of your own work in this particular case.--Andrew Lancaster (talk) 14:55, 24 November 2009 (UTC)

New Take on the Section name issue

Andrew keeps referring the the WP:HGH discussion. I looked on the HGH page several times and could not find it, finally I found this within the archive, the only discussion that I found that dealt with section heads. I want to highlight this so that I can show that his choice of section heads really is a matter of his opinion and not a collective discussion. I will highlight the following, the discussion only involved two people, here it is.

Currently, Wikipedia Y-DNA articles use the first method for article titles and the a mix of both in the text. Hopefully we can generate a consensus as to which method we will use from here on out. In closing, I would like to remind everyone that the hierarchical haplogroup nomenclature, like the field itself, has been changing very rapidly; to illustrate this, take a look at Y haplogroup trees from 2002, 2005, 2006, 2007, early 2008, and mid 2008. – Swid (talk · edits) 14:20, 25 August 2008 (UTC)

This subject certainly needs discussion and review every few months. FWIW the E1b1b article is perhaps a good place to see a debate in action about it. There is not only the current awkward discussion, but also an earlier one after Karafet etc was absorbed by the community: same people involved. [2] Furthermore, during this current stand off, I put quite a case together, only to have it archived a few hours later! [3] --Andrew Lancaster (talk) 14:27, 25 August 2008 (UTC)

I should note that when I came to the E1b1b article in July it was a mess. Its still a mess. So....Andrew where is this decision and discussion in WP:HGH that you are referring to?PB666 yap 03:54, 24 November 2009 (UTC)

I should also note that swid, the other person involved has not been on Wikipedia since 18:07, 11 November 2008, so that the only person here who was part of that discussion is you Andrew and no advice was given. So you can stop that little diversion. We as a people need to make a decision, you are not going to force the answer you decided with E1b1b page on this page, let the different editors here decide. However, given this person last comment and the WP:MOS on section headers not be subject to change I would like to highlight this statement as validation of what I said.

This appears to be a clear case of Andrew trying to grandstand the issue.PB666 yap 04:14, 24 November 2009 (UTC)

Why are you scared of moving this discussion to WP:HGH? If as you claim no one is reading it, then we'll see right?--Andrew Lancaster (talk) 06:47, 24 November 2009 (UTC)
Argumentative reply trying to evade the facts.PB666 yap 13:34, 24 November 2009 (UTC)
OK, if you'd rather discuss all Y haplogroups here on the wrong forum, against my advice, what then is your proposal and what convincing argument can you make?
I think the first and most basic question is whether the situation is such that we can make or should make one policy for all situations. My initial vote would be "no".
My explanation: My experience on these articles is that this leads to edit wars and unstable consensus. Remember, in the archived debates on WP:HGH (I think you only found one so far?) I was the one proposing mutational naming initially because more stable, exactly what you are now arguing. I compromised with other editors and I think that was the right thing to do. The counter argument is that these Y haplogroups are now something many non scientists discuss, but nearly always using the phylogenetic naming. Non specialist readers need the most help to follow this stuff, so their needs trump the needs of "standardization" at least for the time being.--Andrew Lancaster (talk) 15:56, 24 November 2009 (UTC)
But on the other hand I want to remind you that the particular under discussion here was quite specific. These are special sub-sections about the DIFFERENT names which readers might come across.
Can you see any errors in what I am saying?--Andrew Lancaster (talk) 15:56, 24 November 2009 (UTC)
That reply is the best of replies so far. I accept this as a reasoning, but I must again restate with both yours and Swins statements the possibility of changing phylogenetics exist. My opinion is that we should keep pressing the issue of preference here and to people who have written other Y-DNA pages before coming to a decision. If there is a grand preference for the dual naming scheme and the #section links will not be a future problem, because people understand they might be disrupted they can link to Redirect pages, for example, then I would favor the dual system. So far Andrew it only you and me, should we make the decision by simply flipping a coin, that is what the current debate amounts to.PB666 yap 16:33, 24 November 2009 (UTC)
It is the kind of reply you might have gotten on the correct forum also, and if you read through more of the archives, you'll find the same basic history. I believe that concerning this specific case here in this specific sub-section, which is specifically about name changes and the like, two names are necessary.--Andrew Lancaster (talk) 16:50, 24 November 2009 (UTC)
OK, if you'd rather discuss all Y haplogroups here on the wrong forum, against my advice, what then is your proposal and what convincing argument can you make?
I think the first and most basic question is whether the situation is such that we can make or should make one policy for all situations. My initial vote would be "no".
My explanation: My experience on these articles is that this leads to edit wars and unstable consensus. Remember, in the archived debates on WP:HGH (I think you only found one so far?) I was the one proposing mutational naming initially because more stable, exactly what you are now arguing. I compromised with other editors and I think that was the right thing to do. The counter argument is that these Y haplogroups are now something many non scientists discuss, but nearly always using the phylogenetic naming. Non specialist readers need the most help to follow this stuff, so their needs trump the needs of "standardization" at least for the time being.--Andrew Lancaster (talk) 15:56, 24 November 2009 (UTC)
But on the other hand I want to remind you that the particular under discussion here was quite specific. These are special sub-sections about the DIFFERENT names which readers might come across.
Can you see any errors in what I am saying?--Andrew Lancaster (talk) 15:56, 24 November 2009 (UTC)
That reply is the best of replies so far. I accept this as a reasoning, but I must again restate with both yours and Swins statements there is a consensus belief of a changing phylogenetics exist. The real question is whether this is pertinent to R1a, I would argue not. First there are very few west Eurasian cased of old R1* that are not M420. Therefore an insertion between R1 and M420 that disrupts the R1a clade is not likely. There are not a large number of R1a at present and their distribution and branch age to R1a suggests that they might be related to one of few haplotypes.

There is a significant enough spread of R1a1 that a mutation that splits between R1a1 and R1a1a is likely. So the greater concern in the nomenclature is here. One has to remember that with each level of paraclades in the tree the risk of disrupting the next higher level increases. Consequently the concern is over the labeling of R1a1 and R1a1a. In this process I am treating the R1* of Sharma as potential third clade or R1a* unknowns, there is a risk that R1a* could have evolved in India, and that deeper branches are found there. Reason for down playing the attachment, the Saharia tribe, putatively R1a1* are probably all one type of R1a1 and the Brahmins may be derived migrants from that tribe. Thus I don't see a distribution of R1a1 in India that would be indicative of a point of origin, despite its high frequency given cultural evidence of transmigration between the fertile crescent and India. The nature of R1* in India is a matter of concern. Independent of R1a subclades there is an open possibility that R1a evolved in India and that R1* represents an even more basal branch in the R1a clade. Sharma et al 2009 represents a big enough unknown that we should strongly consider holding off of dual labels until these R1* variants are typed, or excluded as R1a, IMHO.

My opinion is that we should keep pressing the issue of preference here and to people who have written other Y-DNA pages before coming to a decision. If there is a grand preference for the dual naming scheme and the #section links will not be a future problem, because people understand they might be disrupted they can link to redirect pages, for example, then I would favor the dual system. So far Andrew it only you and me, should we make the decision by simply flipping a coin, that is what the current debate amounts to.PB666 yap 16:33, 24 November 2009 (UTC)

BTW, I agree with the naming of E1b1b subclades for the following:
  1. Because the E1b1b1a is already split off and carries a phylogenetic name.
  2. Because branches in Africa tend to be longer and trees less bushy.
  3. Because only 2 males were found in one local with E1b1b type, which means there is a low likelihood that there will be a split between those two males.
  4. Because E1b1b1 shows a pattern of radiation that typifies major population expansions.
  5. Because there is a relatively high likelihood that the E1b1b1b will be split off in the near future.
  6. Because it appears, because of the Coheni linkage (or lack thereof) that E1b1b studies are further progressed.
  7. In contrast, we are 5 months here after a revision of nomenclature with outstanding R1* in India that are not R1b.

PB666 yap 16:57, 24 November 2009 (UTC)

Can we please have this discussion to WP:HGH? (I would advise that all of these points need much more convincing explanation.) For the meantime it is noted that this is a tricky and controversial subject. Understanding and flexibility is important.--Andrew Lancaster (talk) 17:14, 24 November 2009 (UTC)

BTW if there is a specific place you believe has the best discussion, either in an HGH page or in E1b1b it is simple enough to place a diff here for those edits, instead of handwaving about it. I looked, I found those three section that I mention, and there was no informative discussion, just critique and warnings.PB666 yap 16:57, 24 November 2009 (UTC)

I asked you to look at WP:HGH and I said we should discuss it there. It is not a very full talk page. My apologies.--Andrew Lancaster (talk) 17:11, 24 November 2009 (UTC)

I started editing again

Pdeitiker took over editing for a while, and I stopped because these edits were (by his own account) supposedly justified by his frustration at my editing, making it necessary to wait and see the final results. Instead I focused for a while on trying to get talkpage discussion, an effort which failed. I started to edit the article again now. Editors please note that as is my usual habit I have gone to lengths to explain my edits in each part I have worked on. I have rarely reverted anything bigger than a single sentence, and that in only a few cases, which I think are self-explanatory. This is the correct way to work on Wikipedia, and it becomes increasingly important when there are disagreements. The version as it is now, is my new proposal.--Andrew Lancaster (talk) 11:09, 24 November 2009 (UTC)

Many problems with that version. In your lead you have replaced the paragraph that I had, well explained and with some key elements from the article with a version that has a run-on sentence that cannot be understood. PB666 yap 13:09, 24 November 2009 (UTC)
That is your opinion, but not mine. How do we decide in Wikipedia? If no other editors are expressing opinions then I currently represent the 2:1 consensus at least [28], and my work on this page has been given positive feedback over recent weeks by nearly every person associated with it. I am open to any discussion, but the situation seems clear. For the record, here is the sentence you are claiming is superior, being the second sentence in the whole article...
Your version. R1a, as a haplogroup, is a clustering of similar human Y-chromosome types based upon a unique set shared genetic markers that are a consequence of common ancestry.
My version. In other words, it represents one of the major male-lines of humanity.
I think that if our aim is to reduce jargon and increase accessibility, the case is clear. Any other editors, please comment.--Andrew Lancaster (talk) 14:48, 24 November 2009 (UTC)
Phylogeny (Family Tree) - The R1a1a subclades lack any importance to you, both missing from the Lede and this section?
No, of course they are important. The R1a1a sub-clades are discussed a few sentences below in almost the same words as you want to put here. I have already explained, as has MarmadukePercy, that other editors in Wikipedia do not agree with your approach of cherry-picking some favoured details, but not all details, out of the detailed sections, in order to make the lede physically bigger. Indeed, your proposal that ledes should be a fixed % of the article length is also not an agreed aim. Anyway, this subject also has a long history on this article, which raises important consensus issues. You will recall that the article was subject to debilitating edit warring for a long time until recently, a lot of based on exactly this type of geographical cherry picking, and I managed to find an approach to this question which achieved stability of consensus. Stability of Consensus is a basic aim we should have on Wikipedia. I hope you can accept that to aim at consensus.--Andrew Lancaster (talk) 14:48, 24 November 2009 (UTC)
Density statistics such as Poisson analysis apply to spatial patterns of randomness. Statistics covers all aspects of sampling from simple statistics to confidence of distribution limits. The simplist statistic is not to determine confidence limits, the average. The more complex statistics will consider the standard error of mean values (such as the standard error in the frequencies in Gujarat Indias tested groups, Underhill). The most sophisticated statistics will show the confidence limits for various reasons. The cline maps often presented are a form of statistical analysis, although deceptive because computers cannot assess the validity of political or geographic boundaries. You should improve your wording to indicate the type of analyses, E.g. STR analysis for example age estimates, depth of sequence diversity is better than statistics, etc. I should also point out that the STR analysis in the Origins of R1a1a section are not explained well, this is a deficiency that should be a priority improvement.PB666 yap 17:05, 24 November 2009 (UTC)
I can not follow how this relates to mentioning sub-clades in the lede. Have you posted this in the wrong place?--Andrew Lancaster (talk) 17:16, 24 November 2009 (UTC)
R1a1a (R-M17 or R-M198) - "R1a1a (old R1a1) makes up the vast majority of all R1a, over its entire geographic range, and most statistical or other analysis [Weasel wording] of R1a is therefore by definition focused upon it." This sentence is weasely for one, statistics can be any of 1000 different treatments and second all analysis are some form of statistical treatment, I eliminated this sentence for a reason. It describes nothing.PB666 yap 13:09, 24 November 2009 (UTC)
No, the word "statistics" is not what we usually call all the normal analysis, for example making maps to show where cases cluster. Asking that we list all types of possible analysis in the text would not be reasonable in my opinion.--Andrew Lancaster (talk) 14:48, 24 November 2009 (UTC)
Other errors found and fixed, the passage concerning R1a1a7 was added back to the lede. The run-on sentence could not be repaired without a major rewrite of the paragraph. I will get to it tomorrow if it hasn't been corrected.PB666 yap 14:02, 24 November 2009 (UTC)
I think the run-on sentence can be fixed without any WP:DRAMA, and have made a first attempt. Thanks for pointing it out. Concerning sub-clades see above.--Andrew Lancaster (talk) 14:48, 24 November 2009 (UTC)
  1. ^ a b c d e Cite error: The named reference Underhill2009 was invoked but never defined (see the help page).
  2. ^ Underhill et al. (2009)
  3. ^ Underhill et al. (2009)
  4. ^ see : Underhill et al. (2009)
  5. ^ see : Underhill et al. (2009)
  6. ^ a b Regueiro et al. (2006)
  7. ^ Repping et al. 2009
  8. ^ see : Underhill et al. (2009)
Retrieved from "https://en.wikipedia.org/w/index.php?title=Talk:Haplogroup_R1a/Archive_4&oldid=1190232031"